ING4 (NM_001127583) Human Untagged Clone
CAT#: SC322916
ING4 (untagged)-Human inhibitor of growth family, member 4 (ING4), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | my036; p29ING4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001127583, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCGGGGATGTATTTGGAACATTATCTGGACAGTATTGAAAACCTTCCCTTTGAA TTACAGAGAAACTTTCAGCTCATGAGGGACCTAGACCAAAGAACAGAGGACCTGAAGGCT GAAATTGACAAGTTGGCCACTGAGTATATGAGTAGTGCCCGCAGCCTGAGCTCCGAGGAA AAATTGGCCCTTCTCAAACAGATCCAGGAAGCCTATGGCAAGTGCAAGGAATTTGGTGAC GACAAGGTGCAGCTTGCCATGCAGACCTATGAGATGGTGGACAAACACATTCGGCGGCTG GACACAGACCTGGCCCGTTTTGAGGCTGATCTCAAGGAGAAACAGATTGAGTCAAGTGAC TATGACAGCTCTTCCAGCAAAGAAGGCCGGACTCAAAAGGAGAAGAAAGCTGCTCGTGCT CGTTCCAAAGGGAAAAACTCGGATGAAGAAGCCCCCAAGACTGCCCAGAAGAAGTTAAAG CTCGTGCGCACAAGTCCTGAGTATGGGATGCCCTCAGTGACCTTTGGCAGTGTCCACCCC TCTGATGTGTTGGATATGCCTGTGGATCCCAACGAACCCACCTATTGCCTTTGTCACCAG GTCTCCTATGGAGAGATGATTGGCTGTGACAACCCTGATTGTTCCATTGAGTGGTTCCAT TTTGCCTGTGTGGGGCTGACAACCAAGCCTCGGGGGAAATGGTTTTGCCCACGCTGCTCC CAAGAACGGAAGAAGAAA |
Restriction Sites | Please inquire |
ACCN | NM_001127583 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127583.1, NP_001121055.1 |
RefSeq Size | 1452 bp |
RefSeq ORF | 741 bp |
Locus ID | 51147 |
UniProt ID | Q9UNL4 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a tumor suppressor protein that contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. Multiple alternatively spliced transcript variants have been observed that encode distinct proteins. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses a different splice site in the coding region, compared to variant 9. The resulting protein (isoform 3) is shorter by 3 aa compared to isoform 9. Other names for this variant are ING4_v3 and '9 bp skip variant'. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225315 | ING4 (Myc-DDK-tagged)-Human inhibitor of growth family, member 4 (ING4), transcript variant 3 |
CNY 3,990.00 |
|
RC225315L3 | Lenti-ORF clone of ING4 (Myc-DDK-tagged)-Human inhibitor of growth family, member 4 (ING4), transcript variant 3 |
CNY 5,890.00 |
|
RC225315L4 | Lenti-ORF clone of ING4 (mGFP-tagged)-Human inhibitor of growth family, member 4 (ING4), transcript variant 3 |
CNY 5,890.00 |
|
RG225315 | ING4 (tGFP-tagged) - Human inhibitor of growth family, member 4 (ING4), transcript variant 3 |
CNY 4,370.00 |