Bcl2 Binding component 3 (BBC3) (NM_001127240) Human Untagged Clone
CAT#: SC322931
BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JFY-1; JFY1; PUMA |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_001127240 edited
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC ACGACGTGGGTCCCCTGCCAGATTTGTGGCCCCAGGGAGCGCCATGGCCCGCGCACGCCA GGAGGGCAGCTCCCCGGAGCCCGTAGAGGGCCTGGCCCGCGACGGCCCGCGCCCCTTCCC GCTCGGCCGCCTGGTGCCCTCGGCAGTGTCCTGCGGCCTCTGCGAGCCCGGCCTGGCTGC CGCCCCCGCCGCCCCCACCCTGCTGCCCGCTGCCTACCTCTGCGCCCCCACCGCCCCACC CGCCGTCACCGCCGCCCTGGGGGGTTCCCGCTGGCCTGGGGGTCCCCGCAGCCGGCCCCG AGGCCCGCGCCCGGACGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAGCACCTGGAGTC GCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCGGCCCCGGGAGT CCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCGGA CGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGGCACCGCCCCTC ACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAG AGCCCCCGAGATGGAGCCCAATTAGGTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCG GGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGGGACTTTCTCTGCACC ATGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001127240 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127240.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127240.1, NP_001120712.1 |
RefSeq Size | 1827 bp |
RefSeq ORF | 786 bp |
Locus ID | 27113 |
UniProt ID | Q9BXH1 |
Protein Families | Druggable Genome |
Protein Pathways | Huntington's disease, p53 signaling pathway |
Gene Summary | This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) includes an alternate exon in the 5' coding region, resulting in a frameshift for the remainder of the CDS, compared to variant 2. The encoded isoform (1, also known as PUMA-gamma) has the same N-terminus but is otherwise distinct and longer, compared to isoform 2. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
TAT-RasGAP317-326-mediated tumor cell death sensitization can occur independently of Bax and Bak
,Annibaldi, A;Heulot, M;Martinou, JC;Widmann, C;,
Apoptosis Dec 2013.
,PubMed ID 24362790
[BBC3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225345 | BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 1 |
CNY 2,400.00 |
|
RC225345L1 | Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225345L2 | Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC225345L3 | Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225345L4 | Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG225345 | BBC3 (tGFP-tagged) - Human BCL2 binding component 3 (BBC3), transcript variant 1 |
CNY 4,000.00 |
其它Bcl2 Binding component 3产品