AUTS2 (NM_001127232) Human Untagged Clone

CAT#: SC322935

AUTS2 (untagged)-Human autism susceptibility candidate 2 (AUTS2), transcript variant 3



  "NM_001127232" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to AUTS2 (autism susceptibility candidate 2)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBRSL2; MRD26
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322935 representing NM_001127232.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGGCCCGACGCGGGGCCATGGACTCCGCAAAAAGCGGCGGTCGCGGTCGCAGCGAGACCGGGAG
AGGCGCTCCCGGGGCGGGCTGGGGGCCGGCGCGGCCGGCGGCGGCGGGGCTGGCCGGACCCGGGCGCTC
TCACTCGCCTCGTCGTCGGGCTCCGACAAGGAAGACAATGGGAAGCCCCCGTCCTCCGCCCCGTCCCGG
CCCAGACCCCCGCGGAGGAAGCGGAGAGAGTCCACCTCGGCAGAAGAGGACATCATTGATGGATTTGCC
ATGACCAGCTTTGTCACTTTTGAAGCGCTGGAGAAAGATGTAGCACTTAAGCCTCAGGAACGTGTGGAG
AAACGCCAGACGCCCCTGACCAAGAAGAAACGAGAAGCACTTACCAATGGCTTGTCCTTTCATTCAAAG
AAGAGCAGACTCAGCCACCCACACCACTACAGCTCAGATCGAGAAAATGACCGCAATCTCTGCCAGCAC
CTTGGGAAGAGAAAGAAAATGCCGAAGGCACTCAGACAGCTCAAGCCAGGACAGAACAGCTGCAGGGAC
AGTGACAGTGAAAGTGCCAGTGGAGAATCCAAGGGCTTCCACCGGAGCAGCTCTCGGGAAAGGCTCAGT
GATAGTTCAGCTCCTTCCAGCTTGGGAACAGGCTACTTCAGATCAGGGAAGATGTGCCTTGGAGAGGAA
GCATGTCTTAAATCTGGAAATGATATGAAGAGGGATGTCAGCAACACTTCATCCTGGGCCAGTAATAGG
GAGAGTTTCTTTTCTCTCGTCAAATTGCTTAAAGGATTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127232
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127232.2
RefSeq Size 1826 bp
RefSeq ORF 801 bp
Locus ID 26053
UniProt ID Q8WXX7
MW 29.3 kDa
Gene Summary This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. The encoded protein (isoform 3) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...