Aldolase (ALDOA) (NM_001127617) Human Untagged Clone

CAT#: SC323004

ALDOA (untagged)-Human aldolase A, fructose-bisphosphate (ALDOA), transcript variant 4



  "NM_001127617" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-ALDOA rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALDA; GSD12; HEL-S-87p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323004 representing NM_001127617.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTGTCTGACATCGCTCACCGCATC
GTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCC
ATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCTGCTGACAGCTGACGACCGC
GTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAGAAGGCGGATGATGGGCGT
CCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGCGTGGTCCCC
CTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGAGCGCTGTGCCCAGTAC
AAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAACACACCCCCTCAGCC
CTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTG
CCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCAGTATGTGACCGAG
AAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGCACCTTGCTGAAG
CCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTGCCATGGCGACC
GTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGGAGGCCAGAGT
GAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGGGCCCTGACC
TTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGAACCTGAAG
GCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTACACTCCG
AGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127617
Insert Size 1095 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127617.2
RefSeq Size 1630 bp
RefSeq ORF 1095 bp
Locus ID 226
UniProt ID P04075
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway
MW 39.4 kDa
Gene Summary This gene encodes a member of the class I fructose-bisphosphate aldolase protein family. The encoded protein is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. Three aldolase isozymes (A, B, and C), encoded by three different genes, are differentially expressed during development. Mutations in this gene have been associated with Glycogen Storage Disease XII, an autosomal recessive disorder associated with hemolytic anemia. Disruption of this gene also plays a role in the progression of multiple types of cancers. Related pseudogenes have been identified on chromosomes 3 and 10. [provided by RefSeq, Sep 2017]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 2, 3, 4, 7, 8, 9, and 10 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...