SIVA (SIVA1) (NM_021709) Human Untagged Clone

CAT#: SC323987

SIVA1 (untagged)-Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2



  "NM_021709" in other vectors (7)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
SIVA1 mouse monoclonal antibody, clone OTI2F8 (formerly 2F8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD27BP; SIVA; Siva-1; Siva-2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_021709.2 GGGCTGGCGGCCGGGGAGCTGCGTAGCTCCCGGCCCCGCGGCCATGCCCAAGCGGAGCTG
CCCCTTCGCGGACGTGGCCCCGCTACAGCTCAAGGTCCGCGTGAGCCAGAGGGAGTTGAG
CCGCGGCGTGTGCGCCGAGCGCTACTCGCAGGAGGTCTTCGACCCATCTGGGGTAGCGTC
CATTGCCTGTTCCTCATGCGTGCGAGCCGTGGATGGGAAGGCGGTCTGCGGTCAGTGTGA
GCGAGCCCTGTGCGGGCAGTGTGTGCGCACCTGCTGGGGCTGCGGCTCCGTGGCCTGTAC
CCTGTGTGGCCTCGTGGACTGCAGTGACATGTACGAGAAAGTGCTGTGCACCAGCTGTGC
CATGTTCGAGACCTGAGGCTGGCTCAAGCCGGCTGCCTTCACCGGGAGCCACGCCGTGCA
TGGCAGCCTTCCCTGGACGAGCGCTCGGTGTTCACACTGAACTGTGGGGTCGACGGGAGG
GGTGCCTTTTACATGTTCTATTTTGTATCCTAATGACAGAATGAATAAACCTCTTTATAT
TTGCACAAGAAAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_021709
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021709.2, NP_068355.1
RefSeq Size 595 bp
RefSeq ORF 333 bp
Locus ID 10572
UniProt ID O15304
Protein Families Druggable Genome
Gene Summary This gene encodes an E3 ubiquitin ligase that regulates cell cycle progression, cell proliferation and apoptosis. The N-terminus of this protein binds to the cytoplasmic tail of the CD27 antigen, a member of the tumor necrosis factor receptor (TNFR) superfamily. In response to UV radiation-induced DNA damage, this protein has been shown to mediate the ubiquitination of proliferating cell nuclear antigen (PCNA), an important step in translesion DNA synthesis. [provided by RefSeq, Sep 2018]
Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1. It appears to lack the apoptotic properties of Siva. The resulting protein (isoform 2) is shorter when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...