United States
Germany
Japan
United Kingdom
China
EIF3F (NM_003754) Human Untagged Clone
CAT＃: SC324360
EIF3F (untagged)-Human eukaryotic translation initiation factor 3, subunit F (EIF3F)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | eIF3-p47; EIF3S5; MRT67 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003754.2
GACAAGATGGCCACACCGGCGGTACCAGTAAGTGCTCCTCCGGCCACGCCAACCCCAGTC
CCGGCGGCGGCCCCAGCCTCAGTTCCAGCGCCAACGCCAGCACCGGCTGCGGCTCCGGTT CCCGCTGCGGCTCCAGCCTCATCCTCAGACCCTGCGGCAGCAGCGGCTGCAACTGCGGCT CCTGGCCAGACCCCGGCCTCAGCGCAAGCTCCAGCGCAGACCCCAGCGCCCGCTCTGCCT GGTCCTGCTCTTCCAGGGCCCTTCCCCGGCGGCCGCGTGGTCAGGCTGCACCCAGTCATT TTGGCCTCCATTGTGGACAGCTACGAGAGACGCAACGAGGGTGCTGCCCGAGTTATCGGG ACCCTGTTGGGAACTGTCGACAAACACTCAGTGGAGGTCACCAATTGCTTTTCAGTGCCG CACAATGAGTCAGAAGATGAAGTGGCTGTTGACATGGAATTTGCTAAGAATATGTATGAA CTGCATAAAAAAGTTTCTCCAAATGAGCTCATCCTGGGCTGGTACGCTACGGGCCATGAC ATCACAGAGCACTCTGTGCTGATCCATGAGTACTACAGCCGAGAGGCCCCCAACCCCATC CACCTCACTGTGGACACAAGTCTCCAGAACGGCCGCATGAGCATCAAAGCCTACGTCAGC ACTTTAATGGGAGTCCCTGGGAGGACCATGGGAGTGATGTTCACGCCTCTGACAGTGAAA TACGCGTACTACGACACTGAACGCATCGGAGTTGACCTGATCATGAAGACCTGCTTTAGC CCCAACAGAGTGATTGGACTCTCAAGTGACTTGCAGCAAGTAGGAGGGGCATCAGCTCGC ATCCAGGATGCCCTGAGTACAGTGTTGCAATATGCAGAGGATGTACTGTCTGGAAAGGTG TCAGCTGACAATACTGTGGGCCGCTTCCTGATGAGCCTGGTTAACCAAGTACCGAAAATA GTTCCCGATGACTTTGAGACCATGCTCAACAGCAACATCAATGACCTTTTGATGGTGACC TACCTGGCCAACCTCACACAGTCACAGATTGCACTCAATGAAAAACTTGTAAACCTGTGA ATGGACCCCAAGCAGTACACTTGCTGGTCTAGGTATTAACCCCAGGACTCAGAAGTGAAG GAGAAATGGGTTTTTTGTGGTCTTGAGTCACACTGAGATAGTCAGTTGTGTGTGACTCTA ATAAACGGAGCCTACCTTTTGTAAATTAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003754 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003754.2, NP_003745.1 |
| RefSeq Size | 1274 bp |
| RefSeq ORF | 1074 bp |
| Locus ID | 8665 |
| UniProt ID | O00303 |
| Domains | JAB_MPN |
| Protein Families | Druggable Genome |
| Gene Summary | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201740 | EIF3F (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 3, subunit F (EIF3F) |
CNY 5,488.00 |
|
| RC201740L1 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit F (EIF3F), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC201740L2 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit F (EIF3F), mGFP tagged |
CNY 5,890.00 |
|
| RC201740L3 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit F (EIF3F), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201740L4 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit F (EIF3F), mGFP tagged |
CNY 5,890.00 |
|
| RG201740 | EIF3F (tGFP-tagged) - Human eukaryotic translation initiation factor 3, subunit F (EIF3F) |
CNY 7,088.00 |
