ERCC8 (NM_001007234) Human Untagged Clone

CAT#: SC324444

ERCC8 (untagged)-Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3



  "NM_001007234" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
ERCC8 mouse monoclonal antibody, clone OTI2G1 (formerly 2G1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKN1; CSA; UVSS2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001007234.1 GGGGGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACACGATATGCTGGGGTTTT
TGTCCGCACGCCAAACGGGTTTGGAGGACCCTCTTCGCCTTCGGAGAGCAGAGTCAACAC
GGAGAGTTTTGGGACTGGAATTAAATAAAGACAGAGATGTTGAAAGAATCCACGGCGGTG
GAATTAACACCCTTGACATTGAACCTGTTGAAGGGAGATACATGTTATCAGGTGGTTCAG
ATGGTGTGATTGTACTTTATGACCTTGAGAACTCCAGCAGACAATCTTATTACACATGTA
AAGCAGTGTGTTCCATTGGCAGAGATCATCCTGATGTTCACAGATACAGTGTGGAGACTG
TACAGTGGTATCCTCATGACACTGGCATGTTCACATCAAGCTCATTTGATAAAACTCTGA
AAGTATGGGATACAAATACATTACAAACTGCAGATGTATTTAATTTTGAGGAAACAGTTT
ACAGTCATCATATGTCTCCAGTCTCCACCAAGCACTGTTTGGTAGCAGTTGGTACTAGAG
GACCCAAAGTACAACTTTGTGACTTGAAGTCTGGATCCTGTTCTCACATTCTACAGGGTA
TTTTTATTTTATTTCAAACGGCAACTACTTTGAGTAAACGATTCAATAAAAAGAAACGTT
ACTAACAGTGTATTCTTTGTAAGTGACATGACTAATGTACTTTGTGCTGGTTGTTGAGAC
TCAGCAGGGAAATAAAGATCCTTCTGTGCATTATTCTTATAAAACTGAACCATTGAAAAC
ACATTTATATGAACAATGATCATTGGGGAAGCTCAAACAATATGAAAAATAGTTCTAACT
CAAAACCTTGTGTTATTTCTACATTAAAAAAACTAATGCAACTCAGAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001007234
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007234.1, NP_001007235.1
RefSeq Size 925 bp
RefSeq ORF 618 bp
Locus ID 1161
UniProt ID Q13216
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Nucleotide excision repair, Ubiquitin mediated proteolysis
Gene Summary This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) lacks several 3' exons and has an alternate 3' end compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...