DP2 (TFDP2) (NM_006286) Human Untagged Clone
CAT#: SC324487
TFDP2 (untagged)-Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2
CNY 3,656.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DP2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006286.1
CATTTGTTGCATTTCCAGTTTCCAATACCAACTCACCTACAAAGATTTTACCAAAAACCT
TAGGACCAATAAATGTGAATGTTGGACCCCAAATGATTATAAGCACACCACAGAGACTAA CCAGTTCAGGAAGTGTTCTGATTGGGAGTCCATATACCCCTGCACCAGCAATGGTTACTC AGACACACATAGCAGAAGCTACTGGCTGGGTCCCTGGTGATAGAAAACGGGCTAGAAAAT TTATAGACTCTGATTTTTCAGAAAGTAAACGAAGCAAAAAAGGAGATAAAAATGGGAAAG GCTTGAGACACTTTTCAATGAAAGTGTGTGAGAAAGTTCAACGAAAAGGTACAACATCGT ACAATGAAGTCGCTGATGAGCTGGTGTCAGAGTTCACCAATTCAAATAACCATTTGGCTG CTGATTCGCAGGCTTATGATCAGAAGAACATTAGGCGAAGAGTTTATGATGCTTTAAATG TGCTAATGGCAATGAACATAATTTCAAAGGAAAAAAAAGAAATCAAGTGGATTGGCCTGC CTACCAATTCTGCTCAGGAATGTCAGAATCTGGAGATAGAGAAGCAGAGGCGGATAGAAC GGATAAAGCAGAAGCGGGCCCAGCTGCAAGAACTTCTCCTACAGCAAATCGCTTTCAAAA ACCTGGTACAGAGAAATCGACAAAATGAGCAGCAAAACCAGGGCCCGCCGGCTCTGAACT CTACCATTCAGCTGCCATTCATAATCATCAATACAAGCAGAAAAACAGTCATAGATTGCA GCATCTCCAGTGACAAGTTTGAGTATCTTTTCAATTTTGACAACACCTTTGAGATCCATG ATGACATAGAAGTACTAAAGCGGATGGGAATGTCGTTTGGCCTGGAGTCAGGCAAATGCT CTCTGGAGGATCTGAAACTTGCGAAATCCCTGGTGCCAAAGGCTTTAGAAGGTTATATCA CAGATATCTCCACAGGACCTTCTTGGTTAAATCAGGGACTACTTCTGAACTCTACCCAAT CAGTTTCAAATTTAGACCTGACCACTGGTGCCACCTTACCCCAGTCAAGTGTAAACCAAG GGTTATGCTTGGATGCAGAAGTGGCCTTAGCAACTGGGCAGTTCCTGGCCCCAAACAGTC ACCAGTCCAGCAGTGCGGCCTCTCACTGCTCCGAGTCCCGAGGCGAGACCCCCTGTTCGT TCAATGATGAAGATGAGGAAGATGATGAGGAGGATTCCTCCTCCCCAGAATAAAGACAAG AGAAAGCCTACGTTTCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006286 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006286.1, NP_006277.1 |
RefSeq Size | 2320 bp |
RefSeq ORF | 1161 bp |
Locus ID | 7029 |
UniProt ID | Q14188 |
Domains | E2F_TDP |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Cell cycle |
Gene Summary | The gene is a member of the transcription factor DP family. The encoded protein forms heterodimers with the E2F transcription factors resulting in transcriptional activation of cell cycle regulated genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205845 | TFDP2 (Myc-DDK-tagged)-Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2 |
CNY 3,656.00 |
|
RC205845L1 | Lenti ORF clone of Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC205845L2 | Lenti ORF clone of Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC205845L3 | Lenti ORF clone of Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205845L4 | Lenti ORF clone of Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG205845 | TFDP2 (tGFP-tagged) - Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2 |
CNY 5,256.00 |
|
SC108572 | TFDP2 (untagged)-Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2 |
CNY 3,656.00 |