FXYD7 (NM_022006) Human Untagged Clone

CAT#: SC324488

FXYD7 (untagged)-Human FXYD domain containing ion transport regulator 7 (FXYD7)



  "NM_022006" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal FXYD7 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_022006.1 CCTGCTTCCAGCTGCTGCAGCGCGCCTTCGCCGCCAAAGCATCCAGCAGCCCCCTGCTCC
GGCCCAGCATGGCGACCCCGACCCAGACCCCCACAAAGGCTCCTGAGGAACCTGACCCAT
TTTACTATGACTACAACACGGTGCAGACTGTGGGCATGACTCTGGCAACCATCTTGTTCC
TGCTGGGTATCCTCATCGTCATCAGCAAGAAGGTGAAGTGCAGGAAGGCGGACTCCAGGT
CTGAGAGCCCAACCTGCAAATCCTGTAAGTCTGAGCTTCCCTCTTCAGCCCCTGGTGGCG
GCGGCGTGTAACACCTTCCCGAGGAAACTCCGCTGCCGACCCTGCCTGAGCGCGGGAGCC
TGAGGACCGGGTGGAGGCGGTGGGGACCCAGCCGCGCGCCGGGAGCGCTCCCCGGAATGA
GCCGCCCCACCCACCCCAAGGCTGGAGCCGCTGCACCCTGCTGTCCCTCTCCAGGCCTTG
GCAATGACGATCCCCCAAAGAGCCCGTCTGCACCCCAGACCCAGGGCCTCAGGCCTCCAG
CTCCTGGGATCCGGGAGTCCATCCCGGCCCAGCACCCCCAGCATCCCCGTGTATGGCCCC
CCTGCACCTCCTTGTCTCATCCCCGAAGATCCGTCCCCCTGGCCCCTCAGTGTCCATGTC
TTGAGCTTAATAAATGTGCATTTGGTTTTTTCCTCTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_022006
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022006.1, NP_071289.1
RefSeq Size 713 bp
RefSeq ORF 243 bp
Locus ID 53822
UniProt ID P58549
Protein Families Ion Channels: Other, Transmembrane
Gene Summary This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...