TPSAB1 (NM_003294) Human Untagged Clone

CAT#: SC324545

TPSAB1 (untagged)-Human tryptase alpha/beta 1 (TPSAB1)



  "NM_003294" in other vectors (5)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Mouse Monoclonal Tryptase Antibody
    • 1 ml

CNY 6,347.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TPS1; TPS2; TPSB1; TPSB2; Tryptase-2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003294.3 AGAAGGAACAGGGAGCGGCCAGGATGCTGAATCTGCTGCTGCTGGCGCTGCCCGTCCTGG
CGAGCCGCGCCTACGCGGCCCCTGCCCCAGGCCAGGCCCTGCAGCGAGTGGGCATCGTTG
GGGGTCAGGAGGCCCCCAGGAGCAAGTGGCCCTGGCAGGTGAGCCTGAGAGTCCACGGCC
CATACTGGATGCACTTCTGCGGGGGCTCCCTCATCCACCCCCAGTGGGTGCTGACCGCAG
CGCACTGCGTGGGACCGGACGTCAAGGATCTGGCCGCCCTCAGGGTGCAACTGCGGGAGC
AGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCACCCACAGT
TCTACACCGCCCAGATCGGAGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCGGTGAAGG
TCTCCAGCCACGTCCACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCCGGGGA
TGCCGTGCTGGGTCACTGGCTGGGGCGATGTGGACAATGATGAGCGCCTCCCACCGCCAT
TTCCTCTGAAGCAGGTGAAGGTCCCCATAATGGAAAACCACATTTGTGACGCAAAATACC
ACCTTGGCGCCTACACGGGAGACGACGTCCGCATCGTCCGTGACGACATGCTGTGTGCCG
GGAACACCCGGAGGGACTCATGCCAGGGCGACTCCGGAGGGCCCCTGGTGTGCAAGGTGA
ATGGCACCTGGCTGCAGGCGGGCGTGGTCAGCTGGGGCGAGGGCTGTGCCCAGCCCAACC
GGCCTGGCATCTACACCCGTGTCACCTACTACTTGGACTGGATCCACCACTATGTCCCCA
AAAAGCCGTGAGTCAGGCCTGGGTTGGCCACCTGGGTCACTGGAGGACCAACCCCTGCTG
TCCAAAACACCACTGCTTCCTACCCAGGTGGCGACTGCCCCCCACACCTTCCCTGCCCCG
TCCTGAGTGCCCCTTCCTGTCCTAAGCCCCCTGCTCTCTTCTGAGCCCCTTCCCCTGTCC
TGAGGACCCTTCCCCATCCTGAGCCCCCTTCCCTGTCCTAAGCCTGACGCCTGCACTGGG
CCCTCCGGCCCTCCCCTGCCCAGGCAGCTGGTGGTGGGCGCTAATCCTCCTGAGTGCTGG
ACCTCATTAAAGTGCATGGAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003294.3, NP_003285.2
RefSeq Size 1194 bp
RefSeq ORF 828 bp
Locus ID 7177
UniProt ID Q15661
Domains Tryp_SPc
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...