BANF2 (NM_178477) Human Untagged Clone
CAT#: SC324550
BANF2 (untagged)-Human barrier to autointegration factor 2 (BANF2), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BAF-L; BAF2; BAFL; C20orf179 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_178477.2
GGGGGGCCTAAGACATAAGCTGAACCTCTGGCCTGCAGTTCCAGATCCAAGGTGACTGAG
ACAAACTGCCGGCTGCCACTGGCTTATCAGGAGCACCTGAATCTGCTGACACATCAAGGC CACTTTTCTTAGGAGCCCCCTGACTTCCAAAATCAGTGCCTTTGGATTCATCTCTTCCGG GAGAGTTCAGTGTCTTCTGAAATGTTACAAAACGTCCTTCAGAGCAAGAAGGCGTACACG AGGAGCTCGACTCTGTAGAAAGGAGATGGACGACATGTCTCCCAGGCTGAGAGCCTTCCT CTCCGAACCCATTGGAGAAAAGGATGTCTGCTGGGTGGATGGCATCAGCCATGAGCTCGC GATCAATTTGGTCACCAAAGGTATCAATAAGGCCTACATCCTGCTGGGACAATTCCTTCT GATGCACAAGAATGAAGCCGAGTTTCAGAGGTGGCTCATTTGCTGTTTTGGTGCCACTGA GTGTGAGGCCCAGCAGACTTCTCACTGCCTCAAGGAGTGGTGTGCCTGCTTCCTGTAGAC ACAAACCTCATTGCTGCCCCCCACCACCCTCTGGGGAAAATGACGCCTTCTCCACCTGTA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_178477 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178477.2, NP_848572.2 |
RefSeq Size | 629 bp |
RefSeq ORF | 273 bp |
Locus ID | 140836 |
UniProt ID | Q9H503 |
Gene Summary | May play a role in BANF1 regulation and influence tissue-specific roles of BANF1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript but encodes the shorter isoform (1). Both variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209388 | BANF2 (Myc-DDK-tagged)-Human barrier to autointegration factor 2 (BANF2), transcript variant 1 |
CNY 1,200.00 |
|
RC209388L3 | Lenti ORF clone of Human barrier to autointegration factor 2 (BANF2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209388L4 | Lenti ORF clone of Human barrier to autointegration factor 2 (BANF2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG209388 | BANF2 (tGFP-tagged) - Human barrier to autointegration factor 2 (BANF2), transcript variant 1 |
CNY 2,800.00 |