ARHGAP11B (NM_001039841) Human Untagged Clone
CAT#: SC324558
ARHGAP11B (untagged)-Human Rho GTPase activating protein 11B (ARHGAP11B)
CNY 3,600.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B'-T; FAM7B1; GAP (1-8) |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001039841.1
GGGGGTCGGGGCCGCAGAAGTGCCAGACGGGGCCGGAAAGCAGCCGAGCGGAGTTCAAAT
TTGAGAGCGTTTGGAAATTGGAAGACTTGGTGGCGAACGAGGGTCAGGACCTGCATCCTG CCTCAGAGTTATCGACGTATCCGGAATGTGGGATCAGAGGCTGGTGAAGTTGGCCCTGTT GCAGCATCTGCGGGCCTTCTATGGTATTAAGGTGAAGGGTGTCCGTGGGCAGTGCGATCG CAGGAGACATGAAACAGCAGCCACGGAAATAGGGGGTAAAATATTTGGAGTACCTTTTAA TGCACTGCCCCATTCTGCTGTACCAGAATATGGACACATTCCAAGCTTTCTTGTCGATGC TTGCACATCTTTAGAAGAACATATTCATACCGAAGGGCTTTTTCGGAAATCAGGATCTGT GATTCGCCTAAAAGCACTAAAGAATAAAGTGGATCATGGTGAAGGTTGCCTATCTTCTGC ACCTCCTTGTGATATTGCGGGACTTCTTAAGCAGTTTTTTAGGGAACTGCCAGAGCCCAT TCTCCCAGCTGATTTGCATGAAGCACTTTTGAAAGCTCAACAGTTAGGCACAGAGGAAAA GAATAAAGCTATACTGTTGCTCTCCTGTCTTCTGGCTGACCACACAGTTCATGTATTAAG ATACTTCTTTAACTTTCTCAGGAATGTTTCTCTTAGATCCAGTGAGAATAAGATGGATAG CAGCAATCTTGCAGTAATATTTGCACCAAATCTTCTTCAGACAAGTGAAGGACATGAAAA GATGTCTTCTAACGCAGAAAAGAAGGGCGTGTACCAGACTTTATCCTGGAAAAGATACCA GCCATGTTGGGTATTGATGGTCTCTGTGCTACTCCATCACTGGAAGGCTTTGAAGAAGGT GAATATGAAACTCCTGGTGAATATAAGAGAAAGAGAAGACAACGTGTAGGAGATTTTGTT AGTGGAGCACTAAATAAATTTAAACCTAACAGAACACCTTCTATTACACCTCAACAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001039841 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039841.1, NP_001034930.1 |
RefSeq Size | 1045 bp |
RefSeq ORF | 804 bp |
Locus ID | 89839 |
UniProt ID | Q3KRB8 |
Gene Summary | Hominin-specific protein that promotes development and evolutionary expansion of the brain neocortex (PubMed:25721503). Able to promote amplification of basal progenitors in the subventricular zone, producing more neurons during fetal corticogenesis (PubMed:25721503). Does not possess GTPase activator activity (PubMed:25721503).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the protein-coding transcript. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Genes and Mechanisms Involved in the Generation and Amplification of Basal Radial Glial Cells
,Penisson, M;Ladewig, J;Belvindrah, R;Francis, F;,
Front Cell Neurosci
,PubMed ID 31481878
[ARHGAP11B]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210478 | ARHGAP11B (Myc-DDK-tagged)-Human Rho GTPase activating protein 11B (ARHGAP11B) |
CNY 3,600.00 |
|
RC210478L1 | Lenti ORF clone of Human Rho GTPase activating protein 11B (ARHGAP11B), Myc-DDK-tagged |
CNY 6,450.00 |
|
RC210478L3 | Lenti ORF clone of Human Rho GTPase activating protein 11B (ARHGAP11B), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210478L4 | Lenti ORF clone of Human Rho GTPase activating protein 11B (ARHGAP11B), mGFP tagged |
CNY 5,890.00 |
|
RG210478 | ARHGAP11B (tGFP-tagged) - Human Rho GTPase activating protein 11B (ARHGAP11B) |
CNY 5,200.00 |
其它ARHGAP11B产品