LITAF (NM_001136472) Human Untagged Clone

CAT#: SC324750

LITAF (untagged)-Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 2



  "NM_001136472" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-LITAF Polyclonal Antibody
    • 100 ul

CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIG7; SIMPLE; TP53I7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324750 representing NM_001136472.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGTTCCAGGACCTTACCAGGCGGCCACTGGGCCTTCCTCAGCACCATCCGCACCTCCATCCTAT
GAAGAGACAGTGGCTGTTAACAGTTATTACCCCACACCTCCAGCTCCCATGCCTGGGCCAACTACGGGG
CTTGTGACGGGGCCTGATGGGAAGGGCATGAATCCTCCTTCGTATTATACCCAGCCAGCGCCCATCCCC
AATAACAATCCAATTACCGTGCAGACGGTCTACGTGCAGCACCCCATCACCTTTTTGGACCGCCCTATC
CAAATGTGTTGTCCTTCCTGCAACAAGATGATCGTGAGTCAGCTGTCCTATAACGCCGGTGCTCTGACC
TGGCTGTCCTGCGGGAGCCTGTGCCTGCTGGGGTGCATAGCGGGCTGCTGCTTCATCCCCTTCTGCGTG
GATGCCCTGCAGGACGTGGACCATTACTGTCCCAACTGCAGAGCTCTCCTGGGCACCTACAAGCGTTTG
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136472
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136472.1
RefSeq Size 2479 bp
RefSeq ORF 486 bp
Locus ID 9516
UniProt ID Q99732
Protein Families Druggable Genome, Transcription Factors
MW 17.1 kDa
Gene Summary Lipopolysaccharide is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor-alpha (TNF-alpha) and other inflammatory mediators. This gene encodes lipopolysaccharide-induced TNF-alpha factor, which is a DNA-binding protein and can mediate the TNF-alpha expression by direct binding to the promoter region of the TNF-alpha gene. The transcription of this gene is induced by tumor suppressor p53 and has been implicated in the p53-induced apoptotic pathway. Mutations in this gene cause Charcot-Marie-Tooth disease type 1C (CMT1C) and may be involved in the carcinogenesis of extramammary Paget's disease (EMPD). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) has an alternate 5' UTR exon, as compared to variant 1. Variants 1 and 2 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...