JDP2 (NM_001135047) Human Untagged Clone
CAT#: SC324754
JDP2 (untagged)-Human Jun dimerization protein 2 (JDP2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JUNDM2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324754 representing NM_001135047.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGCCTGGGCAGATCCCGGACCCTTCGGTGACCACAGGCTCCCTGCCAGGGCTTGGCCCCCTGACC GGGCTCCCCAGCTCGGCCCTGACTGTGGAGGAGCTGAAATACGCTGACATCCGCAACCTCGGGGCCATG ATTGCACCCTTGCACTTCCTGGAGGTGAAACTGGGCAAGAGGCCCCAGCCCGTGAAAAGTGAGCTAGAT GAGGAAGAGGAGCGAAGGAAAAGGCGCCGGGAGAAGAACAAAGTCGCAGCAGCCCGATGCCGGAACAAG AAGAAGGAGCGCACGGAGTTTCTGCAGCGGGAATCCGAGCGGCTGGAACTCATGAACGCAGAGCTGAAG ACCCAGATTGAGGAGCTGAAGCAGGAGCGGCAGCAGCTCATCCTGATGCTGAACCGACACCGCCCCACC TGCATCGTCCGGACCGACAGTGTCAAGACCCCCGAGTCAGAAGGCAACCCACTGCTCGAGCAGCTCGAG AAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135047 |
Insert Size | 492 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135047.1 |
RefSeq Size | 3801 bp |
RefSeq ORF | 492 bp |
Locus ID | 122953 |
UniProt ID | Q8WYK2 |
Protein Families | Transcription Factors |
MW | 18.7 kDa |
Gene Summary | Component of the AP-1 transcription factor that represses transactivation mediated by the Jun family of proteins. Involved in a variety of transcriptional responses associated with AP-1 such as UV-induced apoptosis, cell differentiation, tumorigenesis and antitumogeneris. Can also function as a repressor by recruiting histone deacetylase 3/HDAC3 to the promoter region of JUN. May control transcription via direct regulation of the modification of histones and the assembly of chromatin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225156 | JDP2 (Myc-DDK-tagged)-Human Jun dimerization protein 2 (JDP2), transcript variant 2 |
CNY 1,200.00 |
|
RC225156L3 | Lenti ORF clone of Human Jun dimerization protein 2 (JDP2), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC225156L4 | Lenti ORF clone of Human Jun dimerization protein 2 (JDP2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225156 | JDP2 (tGFP-tagged) - Human Jun dimerization protein 2 (JDP2), transcript variant 2 |
CNY 4,370.00 |