JDP2 (NM_001135048) Human Untagged Clone

CAT#: SC324755

JDP2 (untagged)-Human Jun dimerization protein 2 (JDP2), transcript variant 3



  "NM_001135048" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


JDP2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JUNDM2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324755 representing NM_001135048.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCCTGGGCAGATCCCGGACCCTTCGGTGACCACAGGCTCCCTGCCAGGGCTTGGCCCCCTGACC
GGGCTCCCCAGCTCGGCCCTGACTGTGGAGGAGCTGAAATACGCTGACATCCGCAACCTCGGGGCCATG
ATTGCACCCTTGCACTTCCTGGAGGTGAAACTGGGCAAGAGGCCCCAGCCCGTGAAAAGTGAGCTAGAT
GAGGAAGAGGAGCGAAGGAAAAGGCGCCGGGAGAAGAACAAAGTCGCAGCAGCCCGATGCCGGAACAAG
AAGAAGGAGCGCACGGAGTTTCTGCAGCGGGAATCCGAGCGGCTGGAACTCATGAACGCAGAGCTGAAG
ACCCAGATTGAGGAGCTGAAGCAGGAGCGGCAGCAGCTCATCCTGATGCTGAACCGACACCGCCCCACC
TGCATCGTCCGGACCGACAGTGTCAAGACCCCCGAGTCAGAAGGCAACCCACTGCTCGAGCAGCTCGAG
AAGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135048
Insert Size 492 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135048.1
RefSeq Size 3793 bp
RefSeq ORF 492 bp
Locus ID 122953
UniProt ID Q8WYK2
Protein Families Transcription Factors
MW 18.7 kDa
Gene Summary Component of the AP-1 transcription factor that represses transactivation mediated by the Jun family of proteins. Involved in a variety of transcriptional responses associated with AP-1 such as UV-induced apoptosis, cell differentiation, tumorigenesis and antitumogeneris. Can also function as a repressor by recruiting histone deacetylase 3/HDAC3 to the promoter region of JUN. May control transcription via direct regulation of the modification of histones and the assembly of chromatin.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...