CDKN3 (NM_001130851) Human Untagged Clone
CAT#: SC324761
CDKN3 (untagged)-Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDI1; CIP2; KAP; KAP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324761 representing NM_001130851.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCCGCCCAGTTCAATACAAACAAGTTGTAAATTTAAAGATGTTAGAAGAAATGTCCAAAAAGAT ACAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCACCAGAGGGGAACTGTCAAAA TATAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTGGAATTATCACCCATCATCATCCAATCGCA GATGGAGGGACTCCTGACATAGCCAGCTGCTGTGAAATAATGGAAGAGCTTACAACCTGCCTTAAAAAT TACCGAAAAACCTTAATACACTGCTATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTA CTATACCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGG GCAATACAGACCATCAAGCAATACAATTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATCTATCA TCAAGAGATTCACAATCAAGATCTGTATCAAGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130851 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001130851.1 |
RefSeq Size | 786 bp |
RefSeq ORF | 519 bp |
Locus ID | 1033 |
UniProt ID | Q16667 |
Protein Families | Druggable Genome, Phosphatase |
MW | 19.4 kDa |
Gene Summary | The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (2) lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225176 | CDKN3 (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2 |
CNY 2,400.00 |
|
RC225176L3 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225176L4 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225176 | CDKN3 (tGFP-tagged) - Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2 |
CNY 4,370.00 |