DDAH1 (NM_001134445) Human Untagged Clone
CAT#: SC324768
DDAH1 (untagged)-Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DDAH; DDAH-1; DDAHI; HEL-S-16 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001134445 edited
ATGATGAAAGAAGCATTAGAAAAACTTCAGCTCAATATAGTAGAGATGAAAGATGAAAAT GCAACTTTAGATGGCGGAGATGTTTTATTCACAGGCAGAGAATTTTTTGTGGGCCTTTCC AAAAGGACAAATCAACGAGGTGCTGAAATCTTGGCTGATACTTTTAAGGACTATGCAGTC TCCACAGTGCCAGTGGCAGATGGGTTGCATTTGAAGAGTTTCTGCAGCATGGCTGGGCCT AACCTGATCGCAATTGGGTCTAGTGAATCTGCACAGAAGGCCCTTAAGATCATGCAACAG ATGAGTGACCACCGCTACGACAAACTCACTGTGCCTGATGACATAGCAGCAAACTGTATA TATCTAAATATCCCCAACAAAGGGCACGTCTTGCTGCACCGAACCCCGGAAGAGTATCCA GAAAGTGCAAAGGTTTATGAGAAACTGAAGGACCATATGCTGATCCCCGTGAGCATGTCT GAACTGGAAAAGGTGGATGGGCTGCTCACCTGCTGCTCAGTTTTAATTAACAAGAAAGTA GACTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001134445 |
Insert Size | 4000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001134445.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134445.1, NP_001127917.1 |
RefSeq Size | 4023 bp |
RefSeq ORF | 549 bp |
Locus ID | 23576 |
UniProt ID | O94760 |
Gene Summary | This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225195 | DDAH1 (Myc-DDK-tagged)-Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2 |
CNY 2,400.00 |
|
RC225195L3 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225195L4 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225195 | DDAH1 (tGFP-tagged) - Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2 |
CNY 4,370.00 |