IL18BP (NM_001145057) Human Untagged Clone
CAT#: SC324779
IL18BP (untagged)-Human interleukin 18 binding protein (IL18BP), transcript variant G
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FVH; IL18BPa |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324779 representing NM_001145057.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGTGCCCACGTC GTCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCCACTGCCTCAGTTAGAAGC ACAAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCAGCTAAGCAGTGTCCAGCATTGGAAGTG ACCTGGCCAGAGGTGGAAGTGCCACTGAATGGAACGCTGAGCTTATCCTGTGTGGCCTGCAGCCGCTTC CCCAACTTCAGCATCCTCTACTGGCTGGGCAATGGTTCCTTCATTGAGCACCTCCCAGGCCGACTGTGG GAGGGGAGCACCAGCCGGGAACGTGGGAGCACAGGTACGCAGCTGTGCAAGGCCTTGGTGCTGGAGCAG CTGACCCCTGCCCTGCACAGCACCAACTTCTCCTGTGTGCTCGTGGACCCTGAACAGGTTGTCCAGCGT CACGTCGTCCTGGCCCAGCTCTGGGCTGGGCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCTGCCC TCCAGCCACAGCAGTCCACAGCAGCAGGGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145057 |
Insert Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145057.1 |
RefSeq Size | 1371 bp |
RefSeq ORF | 585 bp |
Locus ID | 10068 |
UniProt ID | O95998 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 21.1 kDa |
Gene Summary | The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (G) differs in the 5' UTR compared to variant A. Variants A, E, F and G encode the same isoform (a, also known as IL-18BPa). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227296 | IL18BP (Myc-DDK-tagged)-Human interleukin 18 binding protein (IL18BP), transcript variant G |
CNY 2,400.00 |
|
RC227296L3 | Lenti ORF clone of Human interleukin 18 binding protein (IL18BP), transcript variant G, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227296L4 | Lenti ORF clone of Human interleukin 18 binding protein (IL18BP), transcript variant G, mGFP tagged |
CNY 5,890.00 |
|
RG227296 | IL18BP (tGFP-tagged) - Human interleukin 18 binding protein (IL18BP), transcript variant G |
CNY 4,370.00 |