SAR1 (SAR1A) (NM_001142648) Human Untagged Clone
CAT#: SC324782
SAR1A (untagged)-Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | masra2; SAR1; Sara; SARA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324782 representing NM_001142648.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTTTCATCTTTGAGTGGATCTACAATGGCTTCAGCAGTGTGCTCCAGTTCCTAGGACTGTACAAG AAATCTGGAAAACTTGTATTCTTAGGTTTGGATAATGCAGGCAAAACCACTCTTCTTCACATGCTCAAA GATGACAGATTGGGCCAACATGTTCCAACACTACATCCGACATCAGAAGAGCTAACAATTGCTGGAATG ACCTTTACAACTTTTGATCTTGGTGGGCACGAGCAAGCACGTCGCGTTTGGAAAAATTATCTCCCAGCA ATTAATGGGATTGTCTTTCTGGTGGACTGTGCAGATCATTCTCGCCTCGTGGAATCCAAAGTTGAGCTT AATGCTTTAATGACTGATGAAACAATATCCAATGTGCCAATCCTTATCTTGGGTAACAAAATTGACAGA ACAGATGCAATCAGTGAAGAAAAACTCCGTGAGATATTTGGGCTTTATGGACAGACCACAGGAAAGGGG AATGTGACCCTGAAGGAGCTGAATGCTCGCCCCATGGAAGTGTTCATGTGCAGTGTGCTCAAGAGGCAA GGTTACGGCGAGGGTTTCCGCTGGCTCTCCCAGTATATTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142648 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142648.1 |
RefSeq Size | 3088 bp |
RefSeq ORF | 597 bp |
Locus ID | 56681 |
UniProt ID | Q9NR31 |
MW | 22.4 kDa |
Gene Summary | Involved in transport from the endoplasmic reticulum to the Golgi apparatus (By similarity). Required to maintain SEC16A localization at discrete locations on the ER membrane perhaps by preventing its dissociation. SAR1A-GTP-dependent assembly of SEC16A on the ER membrane forms an organized scaffold defining endoplasmic reticulum exit sites (ERES).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226577 | SAR1A (Myc-DDK-tagged)-Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1 |
CNY 2,400.00 |
|
RC226577L1 | Lenti ORF clone of Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC226577L2 | Lenti ORF clone of Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC226577L3 | Lenti ORF clone of Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226577L4 | Lenti ORF clone of Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG226577 | SAR1A (tGFP-tagged) - Human SAR1 homolog A (S. cerevisiae) (SAR1A), transcript variant 1 |
CNY 4,370.00 |