United States
Germany
Japan
United Kingdom
China
Secretogranin V (SCG5) (NM_001144757) Human Untagged Clone
CAT＃: SC324792
SCG5 (untagged)-Human secretogranin V (7B2 protein) (SCG5), transcript variant 1
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 7B2; P7B2; SGNE1; SgV |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003020.1
GACCCCCACCAAGGCCCATACCGCAGTAGGCTCCTCGGGCTGCCCCTCGGTTGACAATGG
TCTCCAGGATGGTCTCTACCATGCTATCTGGCCTACTGTTTTGGCTGGCATCTGGATGGA CTCCAGCATTTGCTTACAGCCCCCGGACCCCTGACCGGGTCTCAGAAGCAGATATCCAGA GGCTGCTTCATGGTGTTATGGAGCAATTGGGCATTGCCAGGCCCCGAGTGGAATATCCAG CTCACCAGGCCATGAATCTTGTGGGCCCCCAGAGCATTGAAGGTGGAGCTCATGAAGGAC TTCAGCATTTGGGTCCTTTTGGCAACATCCCCAACATCGTGGCAGAGTTGACTGGAGACA ACATTCCTAAGGACTTTAGTGAGGATCAGGGGTACCCAGACCCTCCAAATCCCTGTCCTG TTGGAAAAACAGCAGATGATGGATGTCTAGAAAACACCCCTGACACTGCAGAGTTCAGTC GAGAGTTCCAGTTGCACCAGCATCTCTCTGATCCGGAACATGACTATCCAGGCTTGGGCA AGTGGAACAAGAAACTCCTTTACGAGAAGATGAAGGGAGGAGAGAGACGAAAGCGGAGGA GTGTCAATCCATATCTACAAGGACAGAGACTGGATAATGTTGTTGCAAAGAAGTCTGTCC CCCATTTTTCAGATGAGGATAAGGATCCAGAGTAAAGAGAAGATGCTAGACGAAAACCCA CATTACCTGTTAGGCCTCAGCATGGCTTATGTGCACGTGTAAATGGAGTCCCTGTGAATG ACAGCATGTTTCTTACATAGATAATTATGGATACAAAGCAGCTGTATGTAGATAGTGTAT TGTCTTCACACCGATGATTCTGCTTTTTGCTAAATTAGAATAAGAGCTTTTTTGTTTCTT GGGTTTTTAAAATGTGAATCTGCAATGATCATAAAAATTAAAATGTGAATGTCAACAATA AAAAGCAAGACTATGAAAGGCTCAGATTTCTTGCAGTTTAAAATGGTGTCTGAGGTTGTA CTATTTTGGCCAAGTCTGTAGAAAGCTGTCATTTGATTTTGATTATGTAGTTCATCCAGC CCTTGGGCATTGTTATACACCAGTAAAGAAGGCTGTACTCAAGAGGAGGAGCTGACACAT TTCACTTGGCTGCGTCTTAATAAACATGAATGCAAGCACAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001144757 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001144757.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001144757.1, NP_001138229.1 |
| RefSeq Size | 1244 bp |
| RefSeq ORF | 639 bp |
| Locus ID | 6447 |
| UniProt ID | P05408 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. This gene also produces a ARHGAP11A-SCG5 readthrough transcript and ARHGAP11A-SCG5 protein. [provided by RefSeq, Feb 2019] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Phosphorylation and alternative splicing of 7B2 reduce prohormone convertase 2 activation
,Ramos-Molina, B;Lindberg, I;,
Mol. Endocrinol.
,PubMed ID 25811241
[SCG5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226541 | SCG5 (Myc-DDK-tagged)-Human secretogranin V (7B2 protein) (SCG5), transcript variant 1 |
CNY 3,600.00 |
|
| RC226541L1 | Lenti ORF clone of Human secretogranin V (7B2 protein) (SCG5), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC226541L2 | Lenti ORF clone of Human secretogranin V (7B2 protein) (SCG5), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
| RC226541L3 | Lenti ORF clone of Human secretogranin V (7B2 protein) (SCG5), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226541L4 | Lenti ORF clone of Human secretogranin V (7B2 protein) (SCG5), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
| RG226541 | SCG5 (tGFP-tagged) - Human secretogranin V (7B2 protein) (SCG5), transcript variant 1 |
CNY 5,200.00 |
其它Secretogranin V产品
