LANPL (ANP32E) (NM_001136479) Human Untagged Clone

CAT#: SC324797

ANP32E (untagged)-Human acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (ANP32E), transcript variant 3



  "NM_001136479" in other vectors (2)

CNY 3,990.00


货期*
详询

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ANP32E Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LANP-L; LANPL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136479, the custom clone sequence may differ by one or more nucleotides
ATGGCTAATGTGGAACTAAGTTCGCTGGCCCGGCTTCCCAGCTTAAATAAACTTCGAAAA
TTGGAGCTTAGTGATAATATAATTTCTGGAGGCTTGGAAGTCCTGGCAGAGAAATGTCCA
AATCTTACCTACCTCAATCTGAGTGGAAACAAAATAAAAGATCTCAGTACAGTAGAAGCT
CTGCAAAATCTTAAAAATTTGAAAAGTCTTGACCTGTTTAACTGTGAGATCACAAACCTG
GAAGATTATAGAGAAAGTATTTTTGAACTACTGCAGCAAATCACATACTTAGATGGATTT
GATCAGGAGGATAATGAAGCGCCGGACTCTGAAGAGGAGGATGATGAGGATGGCGATGAA
GATGATGAAGAGGAAGAGGAAAATGAAGCTGGTCCACCGGAAGGATATGAGGAAGAGGAG
GAGGAAGAGGAAGAGGAGGATGAGGATGAGGATGAAGATGAAGATGAAGCAGGTTCAGAG
TTGGGAGAGGGAGAAGAGGAAGTGGGCCTCTCATACTTAATGAAAGAAGAAATTCAGGAT
GAAGAAGATGATGATGACTATGTTGAAGAAGGGGAAGAAGAGGAAGAAGAGGAAGAAGGA
GGTCTTCGAGGGGAGAAGAGGAAACGAGATGCTGAAGACGATGGAGAGGAAGAAGATGAC
Restriction Sites Please inquire     
ACCN NM_001136479
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136479.1, NP_001129951.1
RefSeq Size 3146 bp
RefSeq ORF 663 bp
Locus ID 81611
UniProt ID Q9BTT0
Protein Families Druggable Genome
Gene Summary Histone chaperone that specifically mediates the genome-wide removal of histone H2A.Z/H2AFZ from the nucleosome: removes H2A.Z/H2AFZ from its normal sites of deposition, especially from enhancer and insulator regions. Not involved in deposition of H2A.Z/H2AFZ in the nucleosome. May stabilize the evicted H2A.Z/H2AFZ-H2B dimer, thus shifting the equilibrium towards dissociation and the off-chromatin state (PubMed:24463511). Inhibits activity of protein phosphatase 2A (PP2A). Does not inhibit protein phosphatase 1. May play a role in cerebellar development and synaptogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at a downstream start codon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...