LANPL (ANP32E) (NM_001136479) Human Untagged Clone
CAT#: SC324797
ANP32E (untagged)-Human acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (ANP32E), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LANP-L; LANPL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001136479, the custom clone sequence may differ by one or more nucleotides
ATGGCTAATGTGGAACTAAGTTCGCTGGCCCGGCTTCCCAGCTTAAATAAACTTCGAAAA TTGGAGCTTAGTGATAATATAATTTCTGGAGGCTTGGAAGTCCTGGCAGAGAAATGTCCA AATCTTACCTACCTCAATCTGAGTGGAAACAAAATAAAAGATCTCAGTACAGTAGAAGCT CTGCAAAATCTTAAAAATTTGAAAAGTCTTGACCTGTTTAACTGTGAGATCACAAACCTG GAAGATTATAGAGAAAGTATTTTTGAACTACTGCAGCAAATCACATACTTAGATGGATTT GATCAGGAGGATAATGAAGCGCCGGACTCTGAAGAGGAGGATGATGAGGATGGCGATGAA GATGATGAAGAGGAAGAGGAAAATGAAGCTGGTCCACCGGAAGGATATGAGGAAGAGGAG GAGGAAGAGGAAGAGGAGGATGAGGATGAGGATGAAGATGAAGATGAAGCAGGTTCAGAG TTGGGAGAGGGAGAAGAGGAAGTGGGCCTCTCATACTTAATGAAAGAAGAAATTCAGGAT GAAGAAGATGATGATGACTATGTTGAAGAAGGGGAAGAAGAGGAAGAAGAGGAAGAAGGA GGTCTTCGAGGGGAGAAGAGGAAACGAGATGCTGAAGACGATGGAGAGGAAGAAGATGAC |
Restriction Sites | Please inquire |
ACCN | NM_001136479 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136479.1, NP_001129951.1 |
RefSeq Size | 3146 bp |
RefSeq ORF | 663 bp |
Locus ID | 81611 |
UniProt ID | Q9BTT0 |
Protein Families | Druggable Genome |
Gene Summary | Histone chaperone that specifically mediates the genome-wide removal of histone H2A.Z/H2AFZ from the nucleosome: removes H2A.Z/H2AFZ from its normal sites of deposition, especially from enhancer and insulator regions. Not involved in deposition of H2A.Z/H2AFZ in the nucleosome. May stabilize the evicted H2A.Z/H2AFZ-H2B dimer, thus shifting the equilibrium towards dissociation and the off-chromatin state (PubMed:24463511). Inhibits activity of protein phosphatase 2A (PP2A). Does not inhibit protein phosphatase 1. May play a role in cerebellar development and synaptogenesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at a downstream start codon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226727 | ANP32E (Myc-DDK-tagged)-Human acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (ANP32E), transcript variant 3 |
CNY 3,990.00 |
|
RG226727 | ANP32E (tGFP-tagged) - Human acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (ANP32E), transcript variant 3 |
CNY 4,370.00 |