TMX2 (NM_001144012) Human Untagged Clone

CAT#: SC324859

TMX2 (untagged)-Human thioredoxin-related transmembrane protein 2 (TMX2), transcript variant 2



  "NM_001144012" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TMX2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-31; NEDMCMS; PDIA12; PIG26; TXNDC14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324859 representing NM_001144012.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGTATTCGGTGCCGCGACTTTCACGATGGCTCGCCCAA
CCTTACTACCTTCTGTCGGCCCTGCTCTCTGCTGCCTTCCTACTCGTGAGGAAACTGCCGCCGCTCTGC
CACGGTCTGCCCACCCAACGCGAAGACGGTAACCCGTGTGACTTTGACTGGAGAGAAGTGGAGATCCTG
ATGTTTCTCAGTGCCATTGTGATGATGAAGAACCGCAGATCCATGTTCCTGATGACGTGCAAACCCCCC
CTATATATGGGCCCTGAGTATATCAAGTACTTCAATGATAAAACCATTGATGAGGAACTAGAACGGGAC
AAGAGGGTCACTTGGATTGTGGAGTTCTTTGCCAATTGGTCTAATGACTGCCAATCATTTGCCCCTATC
TATGCTGACCTCTCCCTTAAATACAACTGTACAGGGCTAAATTTTGGGAAGGTGGATGTTGGACGCTAT
ACTGATGTTAGTACGCGGTACAAAGTGAGCACATCACCCCTCACCAAGCAACTCCCTACCCTGATCCTG
TTCCAAGGTGGCAAGGAGGCAATGCGGCGGCCACAGATTGACAAGAAAGGACGGGCTGTCTCATGGACC
TTCTCTGAGGAGAATGTGATCCGAGAATTTAACTTAAATGAGCTATACCAGCGGGCCAAGAAACTATCA
AAGGCTGGAGACAATATCCCTGAGGAGCAGCCTGTGGCTTCAACCCCCACCACAGTGTCAGATGGGGAA
AACAAGAAGGATAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001144012
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144012.2
RefSeq Size 1627 bp
RefSeq ORF 777 bp
Locus ID 51075
UniProt ID Q9Y320
Protein Families Druggable Genome, Transmembrane
MW 29.6 kDa
Gene Summary This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This protein is enriched on the mitochondria-associated-membrane of the ER via palmitoylation of two of its cytosolically exposed cysteines. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (2) lacks an alternate in-frame exon and uses an alternate in-frame splice junction compared to variant 5. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...