EB2 (MAPRE2) (NM_001143826) Human Untagged Clone
CAT#: SC324879
MAPRE2 (untagged)-Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSCSC2; EB1; EB2; RP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324879 representing NM_001143826.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGTCAATGTGTATTCTACCTCGATAACCCAAGAGACTATGAGCAGACATGACATCATTGCATGG GTTAATGACATAGTATCTTTAAACTACACAAAAGTGGAACAGCTTTGTTCAGGAGCGGCCTATTGCCAA TTCATGGACATGCTCTTCCCTGGCTGCATTAGTTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACAT GAATATATTCACAATTTTAAACTTCTGCAAGCATCATTTAAGCGAATGAACGTTGATAAGGTAATTCCA GTGGAGAAGCTAGTGAAAGGACGTTTCCAGGACAACCTGGATTTTATTCAATGGTTTAAGAAATTCTAT GATGCTAACTACGATGGGAAGGAGTATGATCCTGTAGAGGCACGACAAGGGCAAGATGCAATTCCTCCT CCTGACCCTGGTGAACAGATCTTCAACCTGCCAAAAAAGTCTCACCATGCAAACTCCCCCACAGCAGGT GCAGCTAAATCAAGTCCAGCAGCTAAACCAGGATCCACACCTTCTCGACCCTCATCAGCCAAAAGGGCT TCTTCCAGTGGCTCAGCATCCAAATCCGATAAAGATTTAGAAACGCAGGTCATACAGCTTAATGAACAG GTACATTCATTAAAACTTGCCCTTGAAGGCGTGGAAAAGGAAAGGGATTTCTACTTTGGGAAGTTGAGA GAGATCGAGCTACTCTGCCAAGAACACGGGCAGGAAAATGATGACCTCGTGCAGAGACTAATGGACATC CTGTATGCTTCAGAAGAACACGAGGGCCACACAGAAGAGCCGGAAGCAGAGGAGCAAGCCCACGAACAG CAGCCCCCGCAGCAGGAAGAGTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143826 |
Insert Size | 855 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143826.2 |
RefSeq Size | 4191 bp |
RefSeq ORF | 855 bp |
Locus ID | 10982 |
UniProt ID | Q15555 |
Protein Families | Druggable Genome |
MW | 32.2 kDa |
Gene Summary | The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226771 | MAPRE2 (Myc-DDK-tagged)-Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 2 |
CNY 2,400.00 |
|
RC226771L3 | Lenti ORF clone of Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226771L4 | Lenti ORF clone of Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG226771 | MAPRE2 (tGFP-tagged) - Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 2 |
CNY 4,370.00 |