Mortality Factor 4 like 2 (MORF4L2) (NM_001142431) Human Untagged Clone
CAT#: SC324896
MORF4L2 (untagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 15
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MORFL2; MRGX |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142431, the custom clone sequence may differ by one or more nucleotides
ATGAGTTCCAGAAAGCAGGGTTCTCAACCTCGTGGACAGCAATCTGCAGAAGAAGAGAAC TTCAAAAAACCAACTAGAAGCAACATGCAGAGAAGTAAAATGAGAGGGGCCTCCTCAGGA AAGAAGACAGCTGGTCCACAGCAGAAAAATCTTGAACCAGCTCTCCCAGGAAGATGGGGT GGTCGCTCTGCAGAGAACCCCCCTTCAGGATCCGTGAGGAAGACCAGAAAGAACAAGCAG AAGACTCCTGGAAACGGAGATGGTGGCAGTACCAGCGAAGCACCTCAGCCCCCTCGGAAG AAAAGGGCCCGGGCAGACCCCACTGTTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAG GTTAAAGTGAAGATTCCTGAAGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTT ACCAGGCAGAAGCAGCTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAG GAGTATGCAAATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAAT GAAGTTGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAATGTCC CAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGCAATGTTGGCC TATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCTATTTGCATGATTTCCTA AAATATCTGGCAAAGAATTCTGCATCTCTCTTTACTGCCAGTGATTACAAAGTGGCTTCT GCTGAGTACCACCGCAAAGCCCTG |
Restriction Sites | Please inquire |
ACCN | NM_001142431 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142431.1, NP_001135903.1 |
RefSeq Size | 1876 bp |
RefSeq ORF | 867 bp |
Locus ID | 9643 |
UniProt ID | B3KP92 |
Protein Families | Transcription Factors |
Gene Summary | Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (15) differs in the 5' UTR, compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227358 | MORF4L2 (Myc-DDK-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 15 |
CNY 2,400.00 |
|
RC227358L3 | Lenti-ORF clone of MORF4L2 (Myc-DDK-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 15 |
CNY 5,890.00 |
|
RC227358L4 | Lenti-ORF clone of MORF4L2 (mGFP-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 15 |
CNY 5,890.00 |
|
RG227358 | MORF4L2 (tGFP-tagged) - Human mortality factor 4 like 2 (MORF4L2), transcript variant 15 |
CNY 4,370.00 |
其它MORF4L2产品