United States
Germany
Japan
United Kingdom
China
TBC1D7 (NM_001143965) Human Untagged Clone
CAT＃: SC324901
TBC1D7 (untagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 3
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGCPH; PIG51; TBC7 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001143965, the custom clone sequence may differ by one or more nucleotides
ATGACTGAGGACTCTCAGAGAAACTTTCGTTCAGTATATTATGAGAAAGTGGGGTTTCGT GGAGTTGAAGAAAAGAAATCATTAGAAATTCTCCTAAAAGATGACCGTCTGGATACTGAG AAACTTTGTACTTTTAGTCAGAGGTTCCCTCTCCCGTCCATGTACCGTGCATTGGTATGG AAGGTGCTTCTAGGAATCTTGCCTCCACACCACGAGTCCCATGCCAAGGTGATGATGTAT CGTAAGGAGCAGTACTTGGATGTCCTTCATGCCCTGAAAGTCGTTCGCTTTGTTAGTGAT GCCACACCTCAGGCTGAAGTCTATCTCCGCATGTATCAGCTGGAGTCTGGGAAGTTACCT CGAAGTCCCTCTTTTCCACTGGAGCCAGATGATGAAGTGTTTCTTGCCATAGCTAAAGCC ATGGAGGAAATGGTGGAAGATAGTGTCGACTGTTACTGGATCACCCGACGCTTTGTGAAC CAATTAAATACCAAGTACCGGGATTCCTTGCCCCAGTTGCCAAAAGCGTTTGAACAATAC TTGAATCTGGAAGATGGCAGACTGCTGACTCATCTGAGGATGTGTTCCGCGGCGCCCAAA CTTCCTTATGATCTCTGGTTCAAGAGGTGCTTTGCGGGATGTTTGCCTGAATCCAGTTTA CAGAGGGTTTGGGATAAAGTTGTGAGTGGATCCTGTAAGATCCTAGTTTTTGTAGCTGTC GAAATTTTATTAACCTTTAAAATAAAAGTTATGGCACTGAACAGTGCAGAGAAGATAACA AAGTTTCTGGAAAATATTCCCCAGGACAGCTCAGACGCGATCGTGAGCAAGGCCATTGAC TTGTGGCACAAACACTGTGGGACCCCGGTCCATTCAAGC |
| Restriction Sites | Please inquire |
| ACCN | NM_001143965 |
| Insert Size | 1180 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001143965.1, NP_001137437.1 |
| RefSeq Size | 1180 bp |
| RefSeq ORF | 882 bp |
| Locus ID | 51256 |
| UniProt ID | Q9P0N9 |
| Gene Summary | This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2, 3, and 6 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226903 | TBC1D7 (Myc-DDK-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 3 |
CNY 3,990.00 |
|
| RC226903L3 | Lenti-ORF clone of TBC1D7 (Myc-DDK-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 3 |
CNY 5,890.00 |
|
| RC226903L4 | Lenti-ORF clone of TBC1D7 (mGFP-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 3 |
CNY 5,890.00 |
|
| RG226903 | TBC1D7 (tGFP-tagged) - Human TBC1 domain family, member 7 (TBC1D7), transcript variant 3 |
CNY 4,370.00 |
