United States
Germany
Japan
United Kingdom
China
CD32A (FCGR2A) (NM_001136219) Human Untagged Clone
CAT＃: SC324934
FCGR2A (untagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 1
CNY 3,600.00
| Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD32; CD32A; CDw32; FCG2; FcGR; FCGR2; FCGR2A1; IGFR2 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_001136219 edited
ATGACTATGGAGACCCAAATGTCTCAGAATGTATGTCCCAGAAACCTGTGGCTGCTTCAA CCATTGACAGTTTTGCTGCTGCTGGCTTCTGCAGACAGTCAAGCTGCAGCTCCCCCAAAG GCTGTGCTGAAACTTGAGCCCCCGTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTG ACATGCCAGGGGGCTCGCAGCCCTGAGAGCGACTCCATTCAGTGGTTCCACAATGGGAAT CTCATTCCCACCCACACGCAGCCCAGCTACAGGTTCAAGGCCAACAACAATGACAGCGGG GAGTACACGTGCCAGACTGGCCAGACCAGCCTCAGCGACCCTGTGCATCTGACTGTGCTT TCCGAATGGCTGGTGCTCCAGACCCCTCACCTGGAGTTCCAGGAGGGAGAAACCATCATG CTGAGGTGCCACAGCTGGAAGGACAAGCCTCTGGTCAAGGTCACATTCTTCCAGAATGGA AAATCCCAGAAATTCTCCCATTTGGATCCCACCTTCTCCATCCCACAAGCAAACCACAGT CACAGTGGTGATTACCACTGCACAGGAAACATAGGCTACACGCTGTTCTCATCCAAGCCT GTGACCATCACTGTCCAAGTGCCCAGCATGGGCAGCTCTTCACCAATGGGGATCATTGTG GCTGTGGTCATTGCGACTGCTGTAGCAGCCATTGTTGCTGCTGTAGTGGCCTTGATCTAC TGCAGGAAAAAGCGGATTTCAGCCAATTCCACTGATCCTGTGAAGGCTGCCCAATTTGAG CCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGAC TATGAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGAT AAAAACATCTACCTGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001136219 |
| Insert Size | 2300 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001136219.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001136219.1, NP_001129691.1 |
| RefSeq Size | 2429 bp |
| RefSeq ORF | 954 bp |
| Locus ID | 2212 |
| UniProt ID | P12318 |
| Protein Families | ES Cell Differentiation/IPS, Transmembrane |
| Protein Pathways | Fc gamma R-mediated phagocytosis, Systemic lupus erythematosus |
| Gene Summary | This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Factor VIII Fc Fusion Protein but not FVIII Drives Human Monocyte-Derived Dendritic Cell Activation via FcγRIIa
,Kannicht, C;Danßmann, I;Weilandt, C;Derkow, K;Kohla, G;Geyer, H;,
Hemasphere
,PubMed ID 32072146
[FCGR2A]
|
|
Anti-Peptidoglycan Antibodies and Fc Receptors Are the Key Mediators of Inflammation in Gram-Positive Sepsis
,Dawei Sun, Brent Raisley, Marybeth Langer, Janaki K. Iyer, Vidya Vedham, Jimmy L. Ballard, Judith A. James, Jordan Metcalf, and K. Mark Coggeshall,
J. Immunol., Sep 2012; 189: 2423 - 2431.
[FCGR2A]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227758 | FCGR2A (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 1 |
CNY 2,400.00 |
|
| RC227758L3 | Lenti-ORF clone of FCGR2A (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 1 |
CNY 4,800.00 |
|
| RC227758L4 | Lenti-ORF clone of FCGR2A (mGFP-tagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 1 |
CNY 4,800.00 |
|
| RG227758 | FCGR2A (tGFP-tagged) - Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 1 |
CNY 4,000.00 |
