United States
Germany
Japan
United Kingdom
China
Transmembrane protein 30A (TMEM30A) (NM_001143958) Human Untagged Clone
CAT＃: SC324945
TMEM30A (untagged)-Human transmembrane protein 30A (TMEM30A), transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C6orf67; CDC50A |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001143958, the custom clone sequence may differ by one or more nucleotides
ATGGCGATGAACTATAACGCGAAGGATGAAGTGGACGGTGGGCCCCCGTGTGCTCCGGGG GGCACCGCGAAGACTCGGAGACCGGATAACACGGCCTTCAAACAGCAACGGCTGCCAGCT TGGCAGCCCATCCTTACGGCTGGCACGGTGCTACCTATTTTCTTCATCATCGGTCTCATC TTCATTCCCATCGGCATTGGCATTTTTGTCACCTCCAACAACATCCGCGAGATCGAGGGC AACGTGTTTATGTATTATGGACTGTCTAATTTCTATCAAAACCATCGTCGTTACGTGAAA TCTCGAGATGATAGTCAACTAAATGGAGATTCTAGTGCTTTGCTTAATCCCAGTAAGGAA TGTGAACCTTATCGAAGAAATGAAGACAAACCAATTGCTCCTTGTGGAGCTATTGCCAAC AGCATGTTTAATGATACATTAGAATTGTTTCTCATTGGCAATGATTCTTATCCTATACCT ATCGCTTTGAAAAAGAAAGGTATTGCTTGGTGGACAGATAAAAATGTGAAATTCAGAAAT CCCCCTGGAGGAGACAACCTGGAAGAACGATTTAAAGGTACAACAAAGCCTGTGAACTGG CTTAAACCAGTTTACATGCTGGATTCTGACCCAGATAATAATGGATTCATAAATGAGGAT TTTATTGTTTGGATGCGTACTGCAGCATTACCTACTTTTCGCAAGTTGTATCGTCTTATA GAAAGGAAAAGTGATTTACATCCAACATTACCAGCTGGCCGATACTCTTTGAATGTCACA TACAATTACCCTGTACATTATTTTGATGGACGAAAACGGATGATCTTGAGCACTATTTCA TGGATGGGAGGAAAAAATCCATTTTTGGGGATTGCTTACATCGCTGTTGGATCCATCTCC TTCCTTCTGGGAGTTGTACTGCTAGTAATTAATCATAAATATAGAAACAGTAGTAATACA GCTGACATTACCATT |
| Restriction Sites | Please inquire |
| ACCN | NM_001143958 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001143958.1, NP_001137430.1 |
| RefSeq Size | 4436 bp |
| RefSeq ORF | 978 bp |
| Locus ID | 55754 |
| UniProt ID | Q9NV96 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | Accessory component of a P4-ATPase flippase complex which catalyzes the hydrolysis of ATP coupled to the transport of aminophospholipids from the outer to the inner leaflet of various membranes and ensures the maintenance of asymmetric distribution of phospholipids. Phospholipid translocation seems also to be implicated in vesicle formation and in uptake of lipid signaling molecules. The beta subunit may assist in binding of the phospholipid substrate. Required for the proper folding, assembly and ER to Golgi exit of the ATP8A2:TMEM30A flippase complex. ATP8A2:TMEM30A may be involved in regulation of neurite outgrowth, and, reconstituted to liposomes, predomiminantly transports phosphatidylserine (PS) and to a lesser extent phosphatidylethanolamine (PE). The ATP8A1:TMEM30A flippase complex seems to play a role in regulation of cell migration probably involving flippase-mediated translocation of phosphatidylethanolamine (PE) at the plasma membrane. Required for the formation of the ATP8A2, ATP8B1 and ATP8B2 P-type ATPAse intermediate phosphoenzymes. Involved in uptake of platelet-activating factor (PAF), synthetic drug alkylphospholipid edelfosine, and, probably in association with ATP8B1, of perifosine. Also mediate the export of alpha subunits ATP8A1, ATP8B1, ATP8B2, ATP8B4, ATP10A, ATP10B, ATP10D, ATP11A, ATP11B and ATP11C from the ER to other membrane localizations.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227922 | TMEM30A (Myc-DDK-tagged)-Human transmembrane protein 30A (TMEM30A), transcript variant 2 |
CNY 2,640.00 |
|
| RC227922L3 | Lenti-ORF clone of TMEM30A (Myc-DDK-tagged)-Human transmembrane protein 30A (TMEM30A), transcript variant 2 |
CNY 5,890.00 |
|
| RC227922L4 | Lenti-ORF clone of TMEM30A (mGFP-tagged)-Human transmembrane protein 30A (TMEM30A), transcript variant 2 |
CNY 5,890.00 |
|
| RG227922 | TMEM30A (tGFP-tagged) - Human transmembrane protein 30A (TMEM30A), transcript variant 2 |
CNY 4,370.00 |
其它Transmembrane protein 30A产品
