RPL28 (NM_001136136) Human Untagged Clone
CAT#: SC325441
RPL28 (untagged)-Human ribosomal protein L28 (RPL28), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | L28 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001136136, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCGCATCTGCAATGGATGGTCGTGCGGAACTGCTCCAGTTTCCTGATCAAGAGG AATAAGCAGACCTACAGCACTGAGCCCAATAACTTGAAGGCCCGCAATTCCTTCCGCTAC AACGGACTGATTCACCGCAAGACTGTGGGCGTGGAGCCGGCAGCCGACGGCAAAGGTGTC GTGGTGGTCATTAAGCGGAGATCCGGTGAGTTTTGTCTGGTTTGGGCCAGAGAGCGGCCC CTTTCCCGGGTCTGGGAGCTG |
Restriction Sites | Please inquire |
ACCN | NM_001136136 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136136.1, NP_001129608.1 |
RefSeq Size | 594 bp |
RefSeq ORF | 264 bp |
Locus ID | 6158 |
UniProt ID | P46779 |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L28E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008] Transcript Variant: This variant (4) differs in the 3' UTR and has multiple coding region differences, compared to variant 1. The encoded protein (isoform 4) has a distinct and shorter C-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227594 | RPL28 (Myc-DDK-tagged)-Human ribosomal protein L28 (RPL28), transcript variant 4 |
CNY 3,990.00 |
|
RC227594L3 | Lenti-ORF clone of RPL28 (Myc-DDK-tagged)-Human ribosomal protein L28 (RPL28), transcript variant 4 |
CNY 5,890.00 |
|
RC227594L4 | Lenti-ORF clone of RPL28 (mGFP-tagged)-Human ribosomal protein L28 (RPL28), transcript variant 4 |
CNY 5,890.00 |
|
RG227594 | RPL28 (tGFP-tagged) - Human ribosomal protein L28 (RPL28), transcript variant 4 |
CNY 4,370.00 |