PSMA1 (NM_001143937) Human Untagged Clone
CAT#: SC325490
PSMA1 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HC2; HEL-S-275; NU; PROS30 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001143937, the custom clone sequence may differ by one or more nucleotides
ATGTTTCGAAATCAGTATGACAATGATGTCACTGTTTGGAGCCCCCAGGGCAGGATTCAT CAAATTGAATATGCAATGGAAGCTGTTAAACAAGGTTCAGCCACAGTTGGTCTGAAATCA AAAACTCATGCAGTTTTGGTTGCATTGAAAAGGGCGCAATCAGAGCTTGCAGCTCATCAG AAAAAAATTCTCCATGTTGACAACCATATTGGTATCTCAATTGCGGGGCTTACTGCTGAT GCTAGACTGTTATGTAATTTTATGCGTCAGGAGTGTTTGGATTCCAGATTTGTATTCGAT AGACCACTGCCTGTGTCTCGTCTTGTATCTCTAATTGGAAGCAGTATCCTTTTTATGTTA GCATTTATGGATATGAACTTTGAAGGGTTT |
Restriction Sites | Please inquire |
ACCN | NM_001143937 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143937.1, NP_001137409.1 |
RefSeq Size | 926 bp |
RefSeq ORF | 393 bp |
Locus ID | 5682 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009] Transcript Variant: This variant (3) differs at both the 5' and 3' termini, compared to variant 1. The encoded isoform (3) has a shorter N- and C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226679 | PSMA1 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 3 |
CNY 3,990.00 |
|
RC226679L3 | Lenti-ORF clone of PSMA1 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 3 |
CNY 5,890.00 |
|
RC226679L4 | Lenti-ORF clone of PSMA1 (mGFP-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 3 |
CNY 5,890.00 |
|
RG226679 | PSMA1 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 3 |
CNY 4,370.00 |