United States
Germany
Japan
United Kingdom
China
CSRP1 (NM_001144773) Human Untagged Clone
CAT＃: SC325511
CSRP1 (untagged)-Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CRP; CRP1; CSRP; CYRP; cysteine-rich protein; cysteine and glycine-rich protein 1; D1S181E; DKFZp686M148; LIM-domain protein; OTTHUMP00000033921 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325511 representing NM_001144773.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGAACTGGGGAGGAGGCAAGAAATGTGGGGTGTGTCAGAAGACGGTTTACTTTGCCGAAGAGGTT CAGTGCGAAGGCAACAGCTTCCATAAATCCTGCTTCCTGTGCATGGTCTGCAAGAAGAATCTGGACAGT ACCACTGTGGCCGTGCATGGTGAGGAGATTTACTGCAAGTCCTGCTACGGCAAGAAGTATGGGCCCAAA GGCTATGGCTACGGGCAGGGCGCAGGCACCCTCAGCACTGACAAGGGGGAGTCGCTGGGTATCAAGCAC GAGGAAGCCCCTGGCCACAGGCCCACCACCAACCCCAATGCATCCAAATTTGCCCAGAAGATTGGTGGC TCCGAGCGCTGCCCCCGATGCAGCCAGGCAGTCTATGCTGCGGAGAAGGTGATTGGTGCTGGGAAGGGA TTATTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001144773 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001144773.1 |
| RefSeq Size | 1960 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 1465 |
| MW | 15 kDa |
| Gene Summary | This gene encodes a member of the cysteine-rich protein (CSRP) family. This gene family includes a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this gene product occurs in proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (2) uses a different alternate exon for its 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227847 | CSRP1 (Myc-DDK-tagged)-Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2 |
CNY 1,200.00 |
|
| RC227847L3 | Lenti ORF clone of Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227847L4 | Lenti ORF clone of Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG227847 | CSRP1 (tGFP-tagged) - Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2 |
CNY 4,370.00 |
