LITAF (NM_001136473) Human Untagged Clone
CAT#: SC325522
LITAF (untagged)-Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PIG7; SIMPLE; TP53I7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325522 representing NM_001136473.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGTTCCAGGACCTTACCAGGCGGCCACTGGGCCTTCCTCAGCACCATCCGCACCTCCATCCTAT GAAGAGACAGTGGCTGTTAACAGTTATTACCCCACACCTCCAGCTCCCATGCCTGGGCCAACTACGGGG CTTGTGACGGGGCCTGATGGGAAGGGCATGAATCCTCCTTCGTATTATACCCAGCCAGCGCCCATCCCC AATAACAATCCAATTACCGTGCAGACGGTCTACGTGCAGCACCCCATCACCTTTTTGGACCGCCCTATC CAAATGTGTTGTCCTTCCTGCAACAAGATGATCGTGAGTCAGCTGTCCTATAACGCCGGTGCTCTGACC TGGCTGTCCTGCGGGAGCCTGTGCCTGCTGGGGCAGGAGTGCAGTGGTACGATCGTAGCTCTCCGCAGC TTTGATCTCCTGGGCTCCTGCAATCCGCCCAGCTCAGCCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136473 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136473.1 |
RefSeq Size | 2577 bp |
RefSeq ORF | 459 bp |
Locus ID | 9516 |
UniProt ID | Q99732 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 15.8 kDa |
Gene Summary | Lipopolysaccharide is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor-alpha (TNF-alpha) and other inflammatory mediators. This gene encodes lipopolysaccharide-induced TNF-alpha factor, which is a DNA-binding protein and can mediate the TNF-alpha expression by direct binding to the promoter region of the TNF-alpha gene. The transcription of this gene is induced by tumor suppressor p53 and has been implicated in the p53-induced apoptotic pathway. Mutations in this gene cause Charcot-Marie-Tooth disease type 1C (CMT1C) and may be involved in the carcinogenesis of extramammary Paget's disease (EMPD). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (3) has an alternate 5' UTR exon and an additional exon in the 3' region, as compared to variant 1. The resulting isoform (2) has a different and shorter C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227032 | LITAF (Myc-DDK-tagged)-Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 3 |
CNY 1,200.00 |
|
RC227032L3 | Lenti ORF clone of Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227032L4 | Lenti ORF clone of Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG227032 | LITAF (tGFP-tagged) - Human lipopolysaccharide-induced TNF factor (LITAF), transcript variant 3 |
CNY 4,370.00 |