ATPBD4 (DPH6) (NM_001141972) Human Untagged Clone

CAT#: SC325546

ATPBD4 (untagged)-Human ATP binding domain 4 (ATPBD4), transcript variant 2



  "NM_001141972" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DPH6 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATPBD4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325546 representing NM_001141972.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGGTCGCGGCTCTGATCAGTGGTGGGAAGGACAGCTGCTATAATATGATGCAGTGCATTGCTGCT
GGGCATCAGATCGTTGCTTTAGCAAATCTAAGACCAGCTGAAAACCAAGTGGGGTCTGATGAACTGGAT
AGCTACATGTATCAGACAGTGGGGCACCATGCCATTGACTTGTATGCAGAAGCAATGGCTCTTCCCCTC
TATCGCCGAACCATAAGAGGAAGGAGCTTGGATACAAGACAAGTGTACACCAAATGTGAAGGTGATGAG
GTTGAAGATCTCTATGAGCTTTTGAAACTTGTTAAGGGCATCACTAGAATGACCTTGCTTGCTGAATAT
GATGCTCTGAATCTCCAAGATTTTCACATGCATTTGAAAGTGGGCAGCCAGGCGATTGTTTACAGGACT
CCAAATGAACTGTGCACTCACAGCAAGTTTGATAAACACACATTTCCTCCTTTTATCAGTGAGATTGCA
AAATGTGAAGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001141972
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001141972.1
RefSeq Size 2380 bp
RefSeq ORF 498 bp
Locus ID 89978
UniProt ID Q7L8W6
MW 18.7 kDa
Gene Summary Amidase that catalyzes the last step of diphthamide biosynthesis using ammonium and ATP. Diphthamide biosynthesis consists in the conversion of an L-histidine residue in the translation elongation factor (EEF2) to diphthamide (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...