DOLPP1 (NM_001135917) Human Untagged Clone
CAT#: SC325585
DOLPP1 (untagged)-Human dolichyl pyrophosphate phosphatase 1 (DOLPP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LSFR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325585 representing NM_001135917.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGCGGACGGACAGTGCTCGCTCCCCGCTTCATGGCGGCCGGTGACCCTCACCCACGTCGAATAT CCTGCAGGTGATCTCTCTGGCCACCTCCTTGCCTACCTGAGCCTCAGCCCTGTATTTGTCATCGTCGGT TTCGTGACCCTCATCATATTTAAGCGGGAGCTGCACACGATCTCCTTCCTTGGGGGCCTGGCACTGAAC GAGGGGGTCAACTGGCTGATCAAAAACGTCATCCAGGAGCCACGGCCCTGTGGAGGCCCCCACACAGCA GTGGGCACCAAGTACGGGATGCCCTCCAGCCATTCCCAGTTTATGTGGTTCTTCTCCGTCTATTCCTTC CTTTTCCTGTATTTAAGAATGCACCAAACAAACAACGCCAGGTTCCTGGACTTGCTGTGGAGGCACGTG CTCTCCCTGGGACTCCTCGCTGTGGCCTTCCTAGTCTCCTACAGCAGGCCTGTCTCCGAGTTCTTCCTA ATCCGAGACACAAGCCTCATTCCCAACGTACTCTGGTTTGAGTACACGGTAACCCGGGCAGAAGCCAGG AACAGACAACGCAAGCTGGGGACGAAACTGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135917 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135917.1 |
RefSeq Size | 2096 bp |
RefSeq ORF | 588 bp |
Locus ID | 57171 |
UniProt ID | Q86YN1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | N-Glycan biosynthesis |
MW | 22.1 kDa |
Gene Summary | A similar gene has been characterized in mice and encodes dolichyl pyrophosphate (Dol-P-P) phosphatase. This protein dephosphorylates dolichyl pyrophosphate so that it may be re-utilized as a glycosyl carrier lipid by the oligosaccharyltransferase multisubunit complex in the ER. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform b which is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226887 | DOLPP1 (Myc-DDK-tagged)-Human dolichyl pyrophosphate phosphatase 1 (DOLPP1), transcript variant 2 |
CNY 2,400.00 |
|
RC226887L3 | Lenti ORF clone of Human dolichyl pyrophosphate phosphatase 1 (DOLPP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226887L4 | Lenti ORF clone of Human dolichyl pyrophosphate phosphatase 1 (DOLPP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG226887 | DOLPP1 (tGFP-tagged) - Human dolichyl pyrophosphate phosphatase 1 (DOLPP1), transcript variant 2 |
CNY 4,370.00 |