CITED1 (NM_001144885) Human Untagged Clone
CAT#: SC325620
CITED1 (untagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MSG1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001144885, the custom clone sequence may differ by one or more nucleotides
ATGGAACCATCCGCACAACAGCTCCAGCTGGCAGCATCACTTCCCGCCAATTTATCCAAC TTCTGCCAAGGCTCTGAAATGCCAACAACGTCGAGGCCTGCACTTGATGTCAAGGGTGGC ACCTCACCTGCGAAGGAGGATGCCAACCAAGAGATGAGCTCCGTGGCCTACTCCAACCTT GCGGTGAAAGATCGCAAAGCAGTGGCCATTCTGCACTACCCTGGGGTAGCCTCAAATGGA ACCAAGGCCAGTGGGGCTCCCACTAGTTCCTCGGGATCTCCAATAGGCTCTCCTACAACC ACCCCTCCCACTAAACCCCCATCCTTCAACCTGCACCCCGCCCCTCACTTGCTGGCTAGT ATGCACCTGCAGAAACTTAATAGCCAGTATCAGGGGATGGCTGCTGCCACTCCAGGCCAA CCCGGGGAGGCAGGACCCCTGCAAAACTGGGACTTTGGGGCCCAGGCGGGAGGGGCAGAA TCACTCTCTCCTTCTGCTGGTGCCCAGAGCCCTGCTATCATCGATTCGGACCCAGTGGAT GAGGAAGTGCTGATGTCGCTGGTGGTGGAACTGGGGTTGGACCGAGCCAATGAGCTTCCG GAGCTGTGGCTGGGGCAGAATGAGTTTGACTTCACTGCGGACTTTCCATCTAGCTGC |
Restriction Sites | Please inquire |
ACCN | NM_001144885 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001144885.1, NP_001138357.1 |
RefSeq Size | 951 bp |
RefSeq ORF | 660 bp |
Locus ID | 4435 |
UniProt ID | Q99966 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the CREB-binding protein/p300-interacting transactivator with Asp/Glu-rich C-terminal domain (CITED) family of proteins. The encoded protein, also known as melanocyte-specific gene 1, may function as a transcriptional coactivator and may play a role in pigmentation of melanocytes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (2) contains a distinct 5' UTR and 5' coding region due to the presence of two alternate exons. These differences cause translation initiation at an upstream AUG and result in an isoform (2) with a longer N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227356 | CITED1 (Myc-DDK-tagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2 |
CNY 3,990.00 |
|
RC227356L3 | Lenti-ORF clone of CITED1 (Myc-DDK-tagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2 |
CNY 5,890.00 |
|
RC227356L4 | Lenti-ORF clone of CITED1 (mGFP-tagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2 |
CNY 5,890.00 |
|
RG227356 | CITED1 (tGFP-tagged) - Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2 |
CNY 4,370.00 |