Cyclin D3 (CCND3) (NM_001136125) Human Untagged Clone

CAT#: SC325623

CCND3 (untagged)-Human cyclin D3 (CCND3), transcript variant 3



  "NM_001136125" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CCND3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136125, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGCTGTGTTGCGAAGGCACCCGGCACGCGCCCCGGGCCGGGCCGGACCCGCGG
CTGCTGGGGGACCAGCGTGTCCTGCAGAGCCTGCTCCGCCTGGAGGAGCGCTACGTACCC
CGCGCCTCCTACTTCCAGTGCGTGCAGCGGGAGATCAAGCCGCACATGCGGAAGATGCTG
GCTTACTGGATGCTGGAGGACTGGGAGGTGCTGGTCCTAGGGAAGCTCAAGTGGGACCTG
GCTGCTGTGATTGCACATGATTTCCTGGCCTTCATTCTGCACCGGCTCTCTCTGCCCCGT
GACCGACAGGCCTTGGTCAAAAAGCATGCCCAGACCTTTTTGGCCCTCTGTGCTACAGAT
TATACCTTTGCCATGTACCCGCCATCCATGATCGCCACGGGCAGCATTGGGGCTGCAGTG
CAAGGCCTGGGTGCCTGCTCCATGTCCGGGGATGAGCTCACAGAGCTGCTGGCAGGGATC
ACTGGCACTGAAGTGGACTGCCTGCGGGCCTGTCAGGAGCAGATCGAAGCTGCACTCAGG
GAGAGCCTCAGGGAAGCCTCTCAGACCAGCTCCAGCCCAGCGCCCAAAGCCCCCCGGGGC
TCCAGCAGCCAAGGGCCCAGCCAGACCAGCACTCCTACAGATGTCACAGCCATACACCTG
Restriction Sites Please inquire     
ACCN NM_001136125
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136125.1, NP_001129597.1
RefSeq Size 1879 bp
RefSeq ORF 663 bp
Locus ID 896
UniProt ID P30281
Protein Families Druggable Genome
Protein Pathways Cell cycle, Focal adhesion, Jak-STAT signaling pathway, p53 signaling pathway, Wnt signaling pathway
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 2. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...