SMAD6 (NM_001142861) Human Untagged Clone

CAT#: SC325641

SMAD6 (untagged)-Human SMAD family member 6 (SMAD6), transcript variant 2



  "NM_001142861" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SMAD6 Antibody
    • 100 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AOVD2; HsT17432; MADH6; MADH7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325641 representing NM_001142861.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCAGAATGGGCAAACCCATAGAGACACAAAAATCTCCGCCACCTCCCTACTCTCGGCTGTCTCCT
CGCGACGAGTACAAGCCACTGGATCTGTCCGATTCCACATTGTCTTACACTGAAACGGAGGCTACCAAC
TCCCTCATCACTGCTCCGGGTGAATTCTCAGACGCCAGCATGTCTCCGGACGCCACCAAGCCGAGCCAC
TGGTGCAGCGTGGCGTACTGGGAGCACCGGACGCGCGTGGGCCGCCTCTATGCGGTGTACGACCAGGCC
GTCAGCATCTTCTACGACCTACCTCAGGGCAGCGGCTTCTGCCTGGGCCAGCTCAACCTGGAGCAGCGC
AGCGAGTCGGTGCGGCGAACGCGCAGCAAGATCGGCTTCGGCATCCTGCTCAGCAAGGAGCCCGACGGC
GTGTGGGCCTACAACCGCGGCGAGCACCCCATCTTCGTCAACTCCCCGACGCTGGACGCGCCCGGCGGC
CGCGCCCTGGTCGTGCGCAAGGTGCCCCCCGGCTACTCCATCAAGGTGTTCGACTTCGAGCGCTCGGGC
CTGCAGCACGCGCCCGAGCCCGACGCCGCCGACGGCCCCTACGACCCCAACAGCGTCCGCATCAGCTTC
GCCAAGGGCTGGGGGCCCTGCTACTCCCGGCAGTTCATCACCTCCTGCCCCTGCTGGCTGGAGATCCTC
CTCAACAACCCCAGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142861
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142861.2
RefSeq Size 1293 bp
RefSeq ORF 708 bp
Locus ID 4091
Protein Families Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways TGF-beta signaling pathway
MW 26.2 kDa
Gene Summary The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]
Transcript Variant: This variant uses a different exon at the 5' terminus, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus with a truncated Mad homolog (MH)-1 domain, compared to isoform 1. The variant is also known as SMAD6s.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...