DERL3 (NM_001135751) Human Untagged Clone
CAT#: SC325648
DERL3 (untagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C22orf14; derlin-3; IZP6; LLN2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135751, the custom clone sequence may differ by one or more nucleotides
ATGGCGTGGCAGGGACTAGCGGCCGAGTTCCTGCAGGTGCCGGCGGTGACGCGGGCTTAC ACCGCAGCCTGTGTCCTCACCACCGCCGCGGTGCAGCTGGAGCTCCTCAGCCCCTTTCAA CTCTACTTCAACCCGCACCTTGTGTTCCGGAAGTTCCAGGTCTGGAGGCTCGTCACCAAC TTCCTCTTCTTCGGGCCCCTGGGATTCAGCTTCTTCTTCAACATGCTCTTCGTGTTCCGC TACTGCCGCATGCTGGAAGAGGGCTCCTTCCGCGGCCGCACGGCCGACTTCGTCTTCATG TTTCTCTTCGGGGGCGTCCTTATGACCCTGCTGGGACTCCTGGGCAGCCTGTTCTTCCTG GGCCAGGCCCTCATGGCCATGCTGGTGTACGTGTGGAGCCGCCGCAGCCCTCGGGTGAGG GTCAACTTCTTCGGCCTGCTCACTTTCCAGGCACCGTTCCTGCCTTGGGCGCTCATGGGC TTCTCGCTGCTGCTGGGCAACTCCATCCTCGTGGACCTGCTGGGGATTGCGGTGGGCCAT ATCTACTACTTCCTGGAGGACGTCTTCCCCAACCAGCCTGGAGGCAAGAGGCTCCTGCAG ACCCCTGGCTTCCTGGGACTTCAGAGCAGCAAGGCCCCAGCTGGCAGTAGCCTGACCATC TGGACACAGCAGAGCCAGGGCGGCCCAGGGACGGCAGGAGAGCTCGCGGCACCTTCC |
Restriction Sites | Please inquire |
ACCN | NM_001135751 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135751.1, NP_001129223.1 |
RefSeq Size | 1085 bp |
RefSeq ORF | 720 bp |
Locus ID | 91319 |
UniProt ID | Q96Q80 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228000 | DERL3 (Myc-DDK-tagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 1 |
CNY 3,990.00 |
|
RC228000L3 | Lenti-ORF clone of DERL3 (Myc-DDK-tagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 1 |
CNY 5,890.00 |
|
RC228000L4 | Lenti-ORF clone of DERL3 (mGFP-tagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 1 |
CNY 5,890.00 |
|
RG228000 | DERL3 (tGFP-tagged) - Human Der1-like domain family, member 3 (DERL3), transcript variant 1 |
CNY 4,370.00 |