AZI2 (NM_001134432) Human Untagged Clone
CAT#: SC325655
AZI2 (untagged)-Human 5-azacytidine induced 2 (AZI2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AZ2; NAP1; TILP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134432, the custom clone sequence may differ by one or more nucleotides
ATGGATGCACTGGTAGAAGATGATATCTGTATTCTGAATCATGAAAAAGCCCATAAGAGA GATACAGTGACTCCAGTTTCAATATATTCAGGAGATGAATCTGTTGCTTCCCATTTTGCT CTTGTCACTGCATATGAAGACATCAAAAAACGACTTAAGGATTCAGAGAAAGAGAACTCT TTGTTAAAGAAGAGAATAAGATTTTTGGAAGAAAAGCTAATAGCTCGATTTGAAGAAGAA ACAAGTTCCGTGGGACGAGAACAAGTAAATAAGGCCTATCATGCATATCGAGAGGTTTGC ATTGATAGAGATAATTTGAAGAGCAAACTGGACAAAATGAATAAAGACAACTCTGAATCT TTGAAAGTATTGAATGAGCAGCTACAATCTAAAGAAGTAGAACTCCTCCAGCTGAGGACA GAGGTGGAAACTCAGCAGGTGATGAGGAATTTAAATCCACCTTCATCAAACTGGGAGGTG GAAAAGTTGAGCTGTGACCTGAAGATCCATGGTTTGGAACAAGAGCTGGAACTGATGAGG AAAGAATGTAGCGATCTCAAAATAGAACTACAGAAAGCCAAACAAACGGATCCATATCAG GAAGACAATCTGAAGAGCAGAGATCTCCAAAAACTAAGCATTTCAAGACAGAGTATCTGT AGCACAGCCTGGAGTGCAGTGGCGCAATCATGGGATAGCATGAATTTTGAGGACTGTTCC CTCTTCGCA |
Restriction Sites | Please inquire |
ACCN | NM_001134432 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134432.1, NP_001127904.1 |
RefSeq Size | 1460 bp |
RefSeq ORF | 732 bp |
Locus ID | 64343 |
UniProt ID | Q9H6S1 |
Protein Pathways | RIG-I-like receptor signaling pathway |
Gene Summary | AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225310 | AZI2 (Myc-DDK-tagged)-Human 5-azacytidine induced 2 (AZI2), transcript variant 2 |
CNY 3,990.00 |
|
RC225310L3 | Lenti-ORF clone of AZI2 (Myc-DDK-tagged)-Human 5-azacytidine induced 2 (AZI2), transcript variant 2 |
CNY 5,890.00 |
|
RC225310L4 | Lenti-ORF clone of AZI2 (mGFP-tagged)-Human 5-azacytidine induced 2 (AZI2), transcript variant 2 |
CNY 5,890.00 |
|
RG225310 | AZI2 (tGFP-tagged) - Human 5-azacytidine induced 2 (AZI2), transcript variant 2 |
CNY 4,370.00 |