NFYC (NM_001142590) Human Untagged Clone

CAT#: SC325740

NFYC (untagged)-Human nuclear transcription factor Y, gamma (NFYC), transcript variant 5



  "NM_001142590" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NFYC Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CBF-C; CBFC; H1TF2A; HAP5; HSM; NF-YC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325740 representing NM_001142590.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAGTCGTTCTGG
CCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTGCAGGAACTCCCACTGGCT
CGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATGATCAGTGCAGAAGCGCCTGTACTCTTT
GCCAAGGCAGCCCAGATTTTTATCACAGAGTTGACTCTTCGAGCCTGGATTCACACAGAAGATAACAAG
CGCCGGACTCTACAGAGAAATGATATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATC
GATATTGTTCCAAGAGATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCT
GCCGAGCCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAGCAG
CAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATCGCACAGCCTCAG
CAGGGCCAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCGGTG
CAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACTCAAGTTGTGCAG
GGACAGATCCAGACACTTGCCACCAATGCTCAACAGATTACACAGACAGAGGTCCAGCAAGGACAGCAG
CAGTTCAGCCAGTTCACAGATGGACAGCAGCTCTACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAG
GACCTCGCCCAGCCCATGTTCATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACC
GGCGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142590
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142590.1
RefSeq Size 2380 bp
RefSeq ORF 906 bp
Locus ID 4802
UniProt ID Q13952
Protein Families Transcription Factors
Protein Pathways Antigen processing and presentation
MW 33.7 kDa
Gene Summary This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (5) has an alternate splice pattern in the 5' UTR, lacks an alternate exon in the 3' coding region, and uses an alternate splice site in the central coding region, compared to variant 1. the resulting isoform (5) has the same N- and C- termini but lacks two internal segments, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...