Mu Opioid Receptor (OPRM1) (NM_001145283) Human Untagged Clone
CAT#: SC325879
OPRM1 (untagged)-Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1B2
CNY 6,460.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LMOR; M-OR-1; MOP; MOR; MOR1; OPRM |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145283, the custom clone sequence may differ by one or more nucleotides
ATGGACAGCAGCGCTGCCCCCACGAACGCCAGCAATTGCACTGATGCCTTGGCGTACTCA AGTTGCTCCCCAGCACCCAGCCCCGGTTCCTGGGTCAACTTGTCCCACTTAGATGGCAAC CTGTCCGACCCATGCGGTCCGAACCGCACCGACCTGGGCGGGAGAGACAGCCTGTGCCCT CCGACCGGCAGTCCCTCCATGATCACGGCCATCACGATCATGGCCCTCTACTCCATCGTG TGCGTGGTGGGGCTCTTCGGAAACTTCCTGGTCATGTATGTGATTGTCAGATACACCAAG ATGAAGACTGCCACCAACATCTACATTTTCAACCTTGCTCTGGCAGATGCCTTAGCCACC AGTACCCTGCCCTTCCAGAGTGTGAATTACCTAATGGGAACATGGCCATTTGGAACCATC CTTTGCAAGATAGTGATCTCCATAGATTACTATAACATGTTCACCAGCATATTCACCCTC TGCACCATGAGTGTTGATCGATACATTGCAGTCTGCCACCCTGTCAAGGCCTTAGATTTC CGTACTCCCCGAAATGCCAAAATTATCAATGTCTGCAACTGGATCCTCTCTTCAGCCATT GGTCTTCCTGTAATGTTCATGGCTACAACAAAATACAGGCAAGGTTCCATAGATTGTACA CTAACATTCTCTCATCCAACCTGGTACTGGGAAAACCTGCTGAAGATCTGTGTTTTCATC TTCGCCTTCATTATGCCAGTGCTCATCATTACCGTGTGCTATGGACTGATGATCTTGCGC CTCAAGAGTGTCCGCATGCTCTCTGGCTCCAAAGAAAAGGACAGGAATCTTCGAAGGATC ACCAGGATGGTGCTGGTGGTGGTGGCTGTGTTCATCGTCTGCTGGACTCCCATTCACATT TACGTCATCATTAAAGCCTTGGTTACAATCCCAGAAACTACGTTCCAGACTGTTTCTTGG CACTTCTGCATTGCTCTAGGTTACACAAACAGCTGCCTCAACCCAGTCCTTTATGCATTT CTGGATGAAAACTTCAAACGATGCTTCAGAGAGTTCTGTATCCCAACCTCTTCCAACATT GAGCAACAAAACTCCACTCGAATTCGTCAGAACACTAGAGACCACCCCTCCACGGCCAAT ACAGTGGATAGAACTAATCATCAGAGAGAAAGAAGACAGAAATCTGACTGG |
Restriction Sites | Please inquire |
ACCN | NM_001145283 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145283.1, NP_001138755.1 |
RefSeq Size | 2404 bp |
RefSeq ORF | 1194 bp |
Locus ID | 4988 |
UniProt ID | P35372 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | This gene encodes one of at least three opioid receptors in humans; the mu opioid receptor (MOR). The MOR is the principal target of endogenous opioid peptides and opioid analgesic agents such as beta-endorphin and enkephalins. The MOR also has an important role in dependence to other drugs of abuse, such as nicotine, cocaine, and alcohol via its modulation of the dopamine system. The NM_001008503.2:c.118A>G allele has been associated with opioid and alcohol addiction and variations in pain sensitivity but evidence for it having a causal role is conflicting. Multiple transcript variants encoding different isoforms have been found for this gene. Though the canonical MOR belongs to the superfamily of 7-transmembrane-spanning G-protein-coupled receptors some isoforms of this gene have only 6 transmembrane domains. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (MOR-1B2) represents use of an alternate promoter and 5' UTR, uses a downstream start codon, and uses an alternate 3' exon, compared to variant MOR-1i. The resulting isoform (MOR-1B2) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform MOR-1i. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227223 | OPRM1 (Myc-DDK-tagged)-Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1B2 |
CNY 3,656.00 |
|
RC227223L3 | Lenti-ORF clone of OPRM1 (Myc-DDK-tagged)-Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1B2 |
CNY 5,890.00 |
|
RC227223L4 | Lenti-ORF clone of OPRM1 (mGFP-tagged)-Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1B2 |
CNY 5,890.00 |
|
RG227223 | OPRM1 (tGFP-tagged) - Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1B2 |
CNY 4,370.00 |