uPA (PLAU) (NM_001145031) Human Untagged Clone
CAT#: SC325894
PLAU (untagged)-Human plasminogen activator, urokinase (PLAU), transcript variant 2
CNY 3,656.00
CNY 6,650.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATF; BDPLT5; QPD; u-PA; UPA; URK |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001145031 edited
ATGGTCTTCCATTTGAGAACTAGATACGAACAGGCGAACTGTGACTGTCTAAATGGAGGA ACATGTGTGTCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTC GGAGGGCAGCACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTT TACCGAGGAAAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCC ACTGTCCTTCAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGG AAACATAATTACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTG GGCCTAAAGCCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCC TCCTCTCCTCCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTT AAGATTATTGGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTAC AGGAGGCACCGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGC TGGGTGATCAGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTC TACCTGGGTCGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAA AACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCC TTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACC ATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGC TTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTG AAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACC AAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGG GGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGC CGTGGATGTGCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCC TGGATCCGCAGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001145031 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001145031.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145031.1, NP_001138503.1 |
RefSeq Size | 2680 bp |
RefSeq ORF | 1245 bp |
Locus ID | 5328 |
UniProt ID | P00749 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protease |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | This gene encodes a secreted serine protease that converts plasminogen to plasmin. The encoded preproprotein is proteolytically processed to generate A and B polypeptide chains. These chains associate via a single disulfide bond to form the catalytically inactive high molecular weight urokinase-type plasminogen activator (HMW-uPA). HMW-uPA can be further processed into the catalytically active low molecular weight urokinase-type plasminogen activator (LMW-uPA). This low molecular weight form does not bind to the urokinase-type plasminogen activator receptor. Mutations in this gene may be associated with Quebec platelet disorder and late-onset Alzheimer's disease. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start site compared to variant 1. The encoded isoform (2) has a shorter and distinct N-terminus, and lacks a predicted signal peptide compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227661 | PLAU (Myc-DDK-tagged)-Human plasminogen activator, urokinase (PLAU), transcript variant 2 |
CNY 3,656.00 |
|
RC227661L3 | Lenti-ORF clone of PLAU (Myc-DDK-tagged)-Human plasminogen activator, urokinase (PLAU), transcript variant 2 |
CNY 5,890.00 |
|
RC227661L4 | Lenti-ORF clone of PLAU (mGFP-tagged)-Human plasminogen activator, urokinase (PLAU), transcript variant 2 |
CNY 5,890.00 |
|
RG227661 | PLAU (tGFP-tagged) - Human plasminogen activator, urokinase (PLAU), transcript variant 2 |
CNY 4,370.00 |