PAFAH1B3 (NM_001145940) Human Untagged Clone

CAT#: SC326454

PAFAH1B3 (untagged)-Human platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa (PAFAH1B3), transcript variant 3, mRNA



  "NM_001145940" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Purified PAFAH1B3 mouse monoclonal antibody, clone OTI5D2 (formerly 5D2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAFAHG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326454 representing NM_001145940.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGGAGAGGAGAACCCAGCCAGCAAGCCCACGCCGGTGCAGGACGTACAGGGCGACGGGCGCTGG
ATGTCCCTGCACCATCGGTTCGTGGCTGACAGCAAAGATAAGGAACCCGAAGTCGTCTTCATCGGGGAC
TCCTTGGTCCAGCTCATGCACCAGTGCGAGATCTGGCGCGAGCTCTTCTCTCCTCTGCATGCACTTAAC
TTTGGCATTGGTGGTGACGGCACACAGCATGTACTGTGGCGGCTGGAGAATGGGGAGCTGGAACACATC
CGGCCCAAGATTGTGGTGGTCTGGGTGGGCACCAACAACCACGGACACACAGCAGAGCAGGTGACTGGT
GGCATCAAGGCCATTGTGCAACTGGTGAATGAGCGACAGCCCCAGGCCCGGGTTGTGGTGCTGGGCCTG
CTTCCGCGAGGCCAACATCCCAACCCACTTCGGGAGAAGAACCGACAGGTGAACGAGCTGGTACGGGCG
GCACTGGCTGGCCACCCTCGGGCCCACTTCCTAGATGCCGACCCTGGCTTTGTGCACTCAGATGGCACC
ATCAGCCATCATGACATGTATGATTACCTGCATCTGAGCCGCCTGGGCTACACACCTGTTTGCCGGGCT
CTGCACTCCCTGCTTCTGCGTCTGCTGGCCCAAGACCAGGGCCAAGGTGCTCCCCTGCTGGAGCCCGCA
CCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145940
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145940.1
RefSeq Size 869 bp
RefSeq ORF 696 bp
Locus ID 5050
UniProt ID Q15102
Protein Families Druggable Genome
Protein Pathways Ether lipid metabolism, Metabolic pathways
MW 25.7 kDa
Gene Summary This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with cognitive disability, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...