United States
Germany
Japan
United Kingdom
China
MMP1 (NM_001145938) Human Untagged Clone
CAT＃: SC326474
MMP1 (untagged)-Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2, mRNA
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLG; CLGN |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001145938, the custom clone sequence may differ by one or more nucleotides
ATGCAGGAATTCTTTGGGCTGAAAGTGACTGGGAAACCAGATGCTGAAACCCTGAAGGTG ATGAAGCAGCCCAGATGTGGAGTGCCTGATGTGGCTCAGTTTGTCCTCACTGAGGGGAAC CCTCGCTGGGAGCAAACACATCTGACCTACAGGATTGAAAATTACACGCCAGATTTGCCA AGAGCAGATGTGGACCATGCCATTGAGAAAGCCTTCCAACTCTGGAGTAATGTCACACCT CTGACATTCACCAAGGTCTCTGAGGGTCAAGCAGACATCATGATATCTTTTGTCAGGGGA GATCATCGGGACAACTCTCCTTTTGATGGACCTGGAGGAAATCTTGCTCATGCTTTTCAA CCAGGCCCAGGTATTGGAGGGGATGCTCATTTTGATGAAGATGAAAGGTGGACCAACAAT TTCAGAGAGTACAACTTACATCGTGTTGCAGCTCATGAACTCGGCCATTCTCTTGGACTC TCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTT CAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCT GTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCT ATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAAT CCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAAT GGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAAT AAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGACATCTACAGC TCCTTTGGCTTCCCTAGAACTGTGAAGCATATCGATGCTGCTCTTTCTGAGGAAAACACT GGAAAAACCTACTTCTTTGTTGCTAACAAATACTGGAGGTATGATGAATATAAACGATCT ATGGATCCAGGTTATCCCAAAATGATAGCACATGACTTTCCTGGAATTGGCCACAAAGTT GATGCAGTTTTCATGAAAGATGGATTTTTCTATTTCTTTCATGGAACAAGACAATACAAA TTTGATCCTAAAACGAAGAGAATTTTGACTCTCCAGAAAGCTAATAGCTGGTTCAACTGC AGGAAAAAT |
| Restriction Sites | Please inquire |
| ACCN | NM_001145938 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145938.1, NP_001139410.1 |
| RefSeq Size | 1903 bp |
| RefSeq ORF | 1212 bp |
| Locus ID | 4312 |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| Protein Pathways | Bladder cancer, Pathways in cancer, PPAR signaling pathway |
| Gene Summary | This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down the interstitial collagens, including types I, II, and III. The gene is part of a cluster of MMP genes on chromosome 11. Mutations in this gene are associated with chronic obstructive pulmonary disease (COPD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227181 | MMP1 (Myc-DDK-tagged)-Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2 |
CNY 3,990.00 |
|
| RC227181L3 | Lenti-ORF clone of MMP1 (Myc-DDK-tagged)-Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2 |
CNY 5,890.00 |
|
| RC227181L4 | Lenti-ORF clone of MMP1 (mGFP-tagged)-Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2 |
CNY 5,890.00 |
|
| RG227181 | MMP1 (tGFP-tagged) - Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2 |
CNY 4,370.00 |
