Prostaglandin dehydrogenase 1 (HPGD) (NM_001145816) Human Untagged Clone
CAT#: SC326534
HPGD (untagged)-Human hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 2, mRNA
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 15-PGDH; PGDH; PGDH1; PHOAR1; SDR36C1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326534 representing NM_001145816.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCACGTGAACGGCAAAGTGGCGCTGGTGACCGGCGCGGCTCAGGGCATAGGCAGAGCCTTTGCAGAG GCGCTGCTGCTTAAGGGCGCCAAGGTAGCGCTGGTGGATTGGAATCTTGAAGCAGGTGTACAGTGTAAA GCTGCCCTGGATGAGCAGTTTGAACCTCAGAAGACTCTGTTCATCCAGTGCGATGTGGCTGACCAGCAA CAACTGAGAGACACTTTTAGAAAAGTTGTAGACCACTTTGGAAGACTGGACATTTTGGTCAATAATGCT GGAGTGAATAATGAGAAAAACTGGGAAAAAACTCTGCAAATTAATTTGGTTTCTGTTATCAGTGGAACC TATCTTGGTTTGGATTACATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCT TTAGCAGGACTCATGCCCGTTGCACAGCAGCCGGTTTATTGTGCTTCAAAGCATGGCATAGTTGGATTC ACACGCTCAGCAGCGCCCACCATTGATTGCCAATGGATTGATAACACTCATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145816 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145816.2 |
RefSeq Size | 2880 bp |
RefSeq ORF | 537 bp |
Locus ID | 3248 |
UniProt ID | P15428 |
Protein Families | Druggable Genome |
MW | 19.3 kDa |
Gene Summary | This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226902 | HPGD (Myc-DDK-tagged)-Human hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 2 |
CNY 2,400.00 |
|
RC226902L3 | Lenti ORF clone of Human hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226902L4 | Lenti ORF clone of Human hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
RG226902 | HPGD (tGFP-tagged) - Human hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 2 |
CNY 4,370.00 |
其它Prostaglandin dehydrogenase 1产品