HOMER3 (NM_001145724) Human Untagged Clone

CAT#: SC326559

HOMER3 (untagged)-Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 4, mRNA



  "NM_001145724" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to Homer-3 (homer homolog 3 (Drosophila))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOMER-3; VESL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326559 representing NM_001145724.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCACAGCCAGGGAGCAGCCAATCTTCAGCACACGGGCGCACGTGTTCCAAATTGACCCAGCCACC
AAGCGAAACTGGATCCCAGCGGGCAAGCACGCACTCACTGTCTCCTATTTCTACGATGCCACCCGCAAT
GTGTACCGCATCATCAGCATCGGAGGCGCCAAGGCCATCATCAACAGCACTGTCACTCCCAACATGACC
TTCACCAAAACTTCCCAGAAGTTCGGGCAGTGGGCCGACAGTCGCGCCAACACAGTCTACGGCCTGGGC
TTTGCCTCTGAACAGCATCTGACACAGGTGCCCCCGAGCCCTCTCGTCAGTGCCAACGGCCCCGGCGAG
GAAAAACTGTTCCGCAGCCAGAGCGCTGATGCCCCCGGCCCCACAGAGCGCGAGCGGCTAAAGAAGATG
TTGTCTGAGGGCTCCGTGGGCGAGGTACAGTGGGAGGCCGAGTTTTTCGCACTGCAGGACAGCAACAAC
AAGCTGGCAGGCGCCCTGCGAGAGGCCAACGCCGCCGCAGCCCAGTGGAGGCAGCAGCTGGAGGCTCAG
CGTGCAGAGGCCGAGCGGCTGCGGCAGCGGGTGGCTGAGCTGGAGGCTCAGGCAGCTTCAGAGGTGACC
CCCACCGGTGAGAAGGAGGGGCTGGGCCAGGGCCAGTCGCTGGAACAGCTGGAAGCTCTGGTGCAAACC
AAGGACCAGGAGATTCAGACCCTGAAGAGTCAGACTGGGGGGCCCCGCGAGGCCCTGGAGGCTGCCGAG
CGTGAGGAGACTCAGCAGAAGGTGCAGGACCTGGAGACCCGCAATGCGGAGTTGGAGCACCAGCTGCGG
GCGATGGAGCGCAGCCTGGAGGAGGCACGGGCAGAGCGGGAGCGGGCGCGGGCTGAGGTGGGCCGGGCA
GCGCAGCTGCTGGACGTCAGCCTGTTTGAGCTGAGTGAGCTGCGTGAGGGCCTGGCCCGCCTGGCTGAG
GCTGCGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145724
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145724.1
RefSeq Size 1297 bp
RefSeq ORF 978 bp
Locus ID 9454
UniProt ID Q9NSC5
Protein Families Druggable Genome
MW 36 kDa
Gene Summary This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Transcript Variant: This variant (4), termed Homer-3B00, differs in the 5' UTR and lacks an exon in the coding region, compared to variant 1, but maintains the reading frame. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...