United States
Germany
Japan
United Kingdom
China
Twinkle (TWNK) (NM_001163814) Human Untagged Clone
CAT＃: SC326703
C10orf2 (untagged)-Human chromosome 10 open reading frame 2 (C10orf2) transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATXN8; C10orf2; IOSCA; MTDPS7; PEO; PEO1; PEOA3; PRLTS5; SANDO; SCA8; TWINL |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001163814, the custom clone sequence may differ by one or more nucleotides
ATGCTGACACAGTTTGCCGAGGGGCGGCTGGAAGATCAACTGGACAAATATGATCACTGG GCTGACCGCTTTGAGGACCTGCCCCTCTATTTCATGACTTTCCATGGACAGCAAAGCATC AGGACTGTAATAGATACAATGCAACATGCAGTCTACGTCTATGACATTTGTCATGTGATC ATCGACAACCTGCAGTTCATGATGGGTCACGAGCAGCTGTCCACAGACAGGATCGCAGCT CAAGACTACATCATCGGGGTCTTTCGGAAGTTTGCAACAGACAATAACTGCCATGTGACA CTGGTCATTCACCCCCGGAAAGAGGATGATGACAAGGAACTGCAGACAGCGTCCATTTTT GGCTCAGCCAAAGTGAGTGGCCTT |
| Restriction Sites | Please inquire |
| ACCN | NM_001163814 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163814.1, NP_001157286.1 |
| RefSeq Size | 1844 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 56652 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009] Transcript Variant: This variant (4) has multiple splice site differences, compared to variant 1. The encoded protein (isoform D) lacks most of the N-terminus, which contains a mitochondrial targeting sequence and probable ssDNA binding domain, and has a shorter and distinct C-terminus, which lacks a C-terminal domain required for hexamer formation, compared to isoform A. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228068 | C10orf2 (Myc-DDK-tagged)-Human chromosome 10 open reading frame 2 (C10orf2), transcript variant 4 |
CNY 3,990.00 |
|
| RC228068L3 | Lenti-ORF clone of C10orf2 (Myc-DDK-tagged)-Human chromosome 10 open reading frame 2 (C10orf2), transcript variant 4 |
CNY 5,890.00 |
|
| RC228068L4 | Lenti-ORF clone of C10orf2 (mGFP-tagged)-Human chromosome 10 open reading frame 2 (C10orf2), transcript variant 4 |
CNY 5,890.00 |
|
| RG228068 | C10orf2 (tGFP-tagged) - Human chromosome 10 open reading frame 2 (C10orf2), transcript variant 4 |
CNY 4,370.00 |
其它Twinkle产品
