SCOC (NM_001153484) Human Untagged Clone
CAT#: SC326728
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRIHFB2072; SCOCO; UNC-69 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001153484 edited
ATGCGCAGGCGTGTATTCTCGAGTCAGGATTGGCGGGCGAGCGGCTGGGACGGGATGGGA TTCTTCTCACGGCGCACGTTCTGTGGGCGGAGTGGGCGGAGCTGCCGGGGTCAGTTGGTC CAAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGCGGAA GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAAT GCTGACATGGATGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTT ATTAATCAAGTGTTGGAACTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCA GTTAAGGAAGAAAATCTGAAGCTAAAATCAGAAAACCAAGTTCTTGGACAATATATAGAA AATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACACAAAAAGCAAAAGAAAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001153484 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001153484.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001153484.1, NP_001146956.1 |
RefSeq Size | 1969 bp |
RefSeq ORF | 480 bp |
Locus ID | 60592 |
UniProt ID | Q9UIL1 |
Gene Summary | This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228093 | SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
CNY 3,990.00 |
|
RC228093L3 | Lenti-ORF clone of SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
CNY 5,890.00 |
|
RC228093L4 | Lenti-ORF clone of SCOC (mGFP-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
CNY 5,890.00 |
|
RG228093 | SCOC (tGFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 1 |
CNY 4,370.00 |