EMX2 (NM_001165924) Human Untagged Clone

CAT#: SC326740

EMX2 (untagged)-Human empty spiracles homeobox 2 (EMX2) transcript variant 2



  "NM_001165924" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal EMX2 Antibody
    • 100 ug

CNY 5,808.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001165924, the custom clone sequence may differ by one or more nucleotides
ATGTTCCAGCCGGCGCCCAAGCGCTGCTTCACCATCGAGTCGCTGGTGGCCAAGGACAGT
CCCCTGCCCGCCTCGCGCTCCGAGGACCCCATCCGTCCCGCGGCACTCAGCTACGCTAAC
TCCAGCCCCATAAATCCGTTCCTCAACGGCTTCCACTCGGCCGCCGCCGCCGCCGCCGGT
AGGGGCGTCTACTCCAACCCGGACTTGGTGTTCGCCGAGGCGGTCTCGCACCCGCCCAAC
CCCGCCGTGCCAGTGCACCCGGTGCCGCCGCCGCACGCCCTGGCCGCCCACCCCCTACCC
TCCTCGCACTCGCCACACCCCCTATTCGCCTCGCAGCAGCGGGATCCGTCCACCTTCTAC
CCCTGGCTCATCCACCGCTACCGATATCTGGGTCATCGCTTCCAAGGTAAAAGTATGGTT
TCAGAACCGAAGAACAAAGTTCAAAAGGCAGAAGCTGGAGGAAGAAGGCTCAGATTCGCA
ACAAAAGAAAAAAGGGACGCACCATAT
Restriction Sites Please inquire     
ACCN NM_001165924
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001165924.1, NP_001159396.1
RefSeq Size 2723 bp
RefSeq ORF 510 bp
Locus ID 2018
UniProt ID Q04743
Protein Families Druggable Genome
Gene Summary This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1, which results in a frameshift and a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 1. Isoform 2 lacks the C-terminal homeodomain of isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...