LIM2 (NM_001161748) Human Untagged Clone
CAT#: SC326746
LIM2 (untagged)-Human lens intrinsic membrane protein 2 19kDa (LIM2) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CTRCT19; MP17; MP19 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326746 representing NM_001161748.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACAGCTTCATGGGTGGTGGCCTGTTCTGTGCCTGGGTGGGGACCATCCTCCTGGTGGTGGCCATG GCAACAGACCACTGGATGCAGTACCGGCTGTCAGGGTCCTTCGCCCACCAGGGCCTGTGGCGGTACTGC CTGGGCAACAAGTGCTACCTGCAGACAGACAGCATCGCATACTGGAATGCCACCCGGGCCTTCATGATC CTGTCTGCCCTATGCGCCATCTCCGGCATCATCATGGGCATCATGGCCTTCGCTCATCAGCCTACCTTC TCCCGCATCTCCCGGCCCTTCTCTGCTGGCATCATGTTTTTTTCCTCAACCCTTTTCGTCGTGTTGGCC TTGGCCATCTACACTGGAGTCACCGTCAGCTTCCTGGGCCGCCGCTTTGGGGACTGGCGCTTTTCCTGG TCCTACATCCTGGGCTGGGTGGCAGTGCTCATGACGTTCTTCGCAGGGATTTTCTACATGTGCGCCTAC CGGGTGCATGAATGCCGGCGCCTGTCTACACCCCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001161748 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161748.1 |
RefSeq Size | 875 bp |
RefSeq ORF | 522 bp |
Locus ID | 3982 |
UniProt ID | P55344 |
Protein Families | Druggable Genome, Transmembrane |
MW | 19.7 kDa |
Gene Summary | This gene encodes an eye lens-specific protein found at the junctions of lens fiber cells, where it may contribute to cell junctional organization. It acts as a receptor for calmodulin, and may play an important role in both lens development and cataractogenesis. Mutations in this gene have been associated with cataract formation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate, in-frame donor splice site at the 5' coding exon compared to variant 1. This results in a shorter isoform (2) missing a 42 aa protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228111 | LIM2 (Myc-DDK-tagged)-Human lens intrinsic membrane protein 2, 19kDa (LIM2), transcript variant 2 |
CNY 2,400.00 |
|
RC228111L3 | Lenti ORF clone of Human lens intrinsic membrane protein 2, 19kDa (LIM2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228111L4 | Lenti ORF clone of Human lens intrinsic membrane protein 2, 19kDa (LIM2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG228111 | LIM2 (tGFP-tagged) - Human lens intrinsic membrane protein 2, 19kDa (LIM2), transcript variant 2 |
CNY 4,370.00 |