United States
Germany
Japan
United Kingdom
China
TICAM2 (TMED7-TICAM2) (NM_001164469) Human Untagged Clone
CAT＃: SC326756
TMED7 (untagged)-Human TMED7-TICAM2 read-through transcript (TMED7-TICAM2) transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MyD88-4; TICAM-2; TICAM2; TIRAP3; TIRP; TRAM |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326756 representing NM_001164469.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGCGGCCGGGGTCCGCGCAGCGCTGGGCGGCCGTCGCGGGCCGTTGGGGGTGCAGGCTGCTCGCA CTGCTGCTACTGGTGCCTGGACCCGGCGGCGCCTCTGAGATCACCTTCGAGCTTCCTGACAACGCCAAG CAGTGCTTCTACGAGGACATCGCTCAGGGCACCAAGTGCACCCTGGAGTTCCAGGTGATTACTGGTGGT CACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAAAGTGTTATACAAAGAGATGAAGAAACAG TATGATAGTTTTACCTTCACAGCCTCCAAAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCT ACTTTCACACATAAAACTGTATATTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAG AACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTC ATCGATTATCAGACTCATTTCCGTTTAAGAGAAGCTCAAGGCCGAAGCCGAGCAGAGGATCTAAATACA AGAGTGGCCTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001164469 |
| Insert Size | 567 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001164469.3 |
| RefSeq Size | 3773 bp |
| RefSeq ORF | 567 bp |
| Locus ID | 100302736 |
| UniProt ID | Q86XR7 |
| MW | 21.2 kDa |
| Gene Summary | This locus represents naturally occurring read-through transcription between the neighboring transmembrane emp24 protein transport domain containing 7 (TMED7) and toll-like receptor adaptor molecule 2 (TICAM2) genes. Alternative splicing results in multiple transcript variants, one of which encodes a fusion protein that shares sequence identity with the products of each individual gene. This fusion product functions to negatively regulate the adaptor MyD88-independent toll-like receptor 4 pathway. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (2) uses an alternate splice site that causes an early stop codon in the 3' coding region, compared to variant 1. The encoded isoform (2) has a shorter C-terminus and shares no sequence identity with the downstream TICAM2 gene product, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228121 | TMED7 (Myc-DDK-tagged)-Human TMED7-TICAM2 readthrough (TMED7-TICAM2), transcript variant 2 |
CNY 2,400.00 |
|
| RC228121L3 | Lenti ORF clone of Human TMED7-TICAM2 readthrough (TMED7-TICAM2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC228121L4 | Lenti ORF clone of Human TMED7-TICAM2 readthrough (TMED7-TICAM2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG228121 | TMED7 (tGFP-tagged) - Human TMED7-TICAM2 readthrough (TMED7-TICAM2), transcript variant 2 |
CNY 4,370.00 |
其它TMED7-TICAM2产品
