TICAM2 (TMED7-TICAM2) (NM_001164469) Human Untagged Clone

CAT#: SC326756

TMED7 (untagged)-Human TMED7-TICAM2 read-through transcript (TMED7-TICAM2) transcript variant 2



  "NM_001164469" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TICAM2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MyD88-4; TICAM-2; TICAM2; TIRAP3; TIRP; TRAM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326756 representing NM_001164469.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGCGGCCGGGGTCCGCGCAGCGCTGGGCGGCCGTCGCGGGCCGTTGGGGGTGCAGGCTGCTCGCA
CTGCTGCTACTGGTGCCTGGACCCGGCGGCGCCTCTGAGATCACCTTCGAGCTTCCTGACAACGCCAAG
CAGTGCTTCTACGAGGACATCGCTCAGGGCACCAAGTGCACCCTGGAGTTCCAGGTGATTACTGGTGGT
CACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAAAGTGTTATACAAAGAGATGAAGAAACAG
TATGATAGTTTTACCTTCACAGCCTCCAAAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCT
ACTTTCACACATAAAACTGTATATTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAG
AACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTC
ATCGATTATCAGACTCATTTCCGTTTAAGAGAAGCTCAAGGCCGAAGCCGAGCAGAGGATCTAAATACA
AGAGTGGCCTATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164469
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164469.3
RefSeq Size 3773 bp
RefSeq ORF 567 bp
Locus ID 100302736
UniProt ID Q86XR7
MW 21.2 kDa
Gene Summary This locus represents naturally occurring read-through transcription between the neighboring transmembrane emp24 protein transport domain containing 7 (TMED7) and toll-like receptor adaptor molecule 2 (TICAM2) genes. Alternative splicing results in multiple transcript variants, one of which encodes a fusion protein that shares sequence identity with the products of each individual gene. This fusion product functions to negatively regulate the adaptor MyD88-independent toll-like receptor 4 pathway. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) uses an alternate splice site that causes an early stop codon in the 3' coding region, compared to variant 1. The encoded isoform (2) has a shorter C-terminus and shares no sequence identity with the downstream TICAM2 gene product, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...